ID: 1054889035

View in Genome Browser
Species Human (GRCh38)
Location 9:70232309-70232331
Sequence CTGAGTCATCTCATTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054889027_1054889035 30 Left 1054889027 9:70232256-70232278 CCACTGAGATCGATGCAGAAGGT No data
Right 1054889035 9:70232309-70232331 CTGAGTCATCTCATTGGGACTGG No data
1054889031_1054889035 -10 Left 1054889031 9:70232296-70232318 CCAGCTTAGGTACCTGAGTCATC No data
Right 1054889035 9:70232309-70232331 CTGAGTCATCTCATTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054889035 Original CRISPR CTGAGTCATCTCATTGGGAC TGG Intergenic