ID: 1054891793

View in Genome Browser
Species Human (GRCh38)
Location 9:70259317-70259339
Sequence CCGCGCGCTGCCGGAGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054891793_1054891804 11 Left 1054891793 9:70259317-70259339 CCCGGGGCTCCGGCAGCGCGCGG 0: 1
1: 0
2: 5
3: 30
4: 238
Right 1054891804 9:70259351-70259373 TGGGTGTGTACCTGGCTTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 166
1054891793_1054891801 -8 Left 1054891793 9:70259317-70259339 CCCGGGGCTCCGGCAGCGCGCGG 0: 1
1: 0
2: 5
3: 30
4: 238
Right 1054891801 9:70259332-70259354 GCGCGCGGGCGTGGGCGTGTGGG 0: 1
1: 0
2: 1
3: 20
4: 232
1054891793_1054891802 3 Left 1054891793 9:70259317-70259339 CCCGGGGCTCCGGCAGCGCGCGG 0: 1
1: 0
2: 5
3: 30
4: 238
Right 1054891802 9:70259343-70259365 TGGGCGTGTGGGTGTGTACCTGG 0: 1
1: 0
2: 4
3: 56
4: 735
1054891793_1054891803 10 Left 1054891793 9:70259317-70259339 CCCGGGGCTCCGGCAGCGCGCGG 0: 1
1: 0
2: 5
3: 30
4: 238
Right 1054891803 9:70259350-70259372 GTGGGTGTGTACCTGGCTTGTGG 0: 1
1: 0
2: 0
3: 22
4: 219
1054891793_1054891805 16 Left 1054891793 9:70259317-70259339 CCCGGGGCTCCGGCAGCGCGCGG 0: 1
1: 0
2: 5
3: 30
4: 238
Right 1054891805 9:70259356-70259378 GTGTACCTGGCTTGTGGGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 132
1054891793_1054891800 -9 Left 1054891793 9:70259317-70259339 CCCGGGGCTCCGGCAGCGCGCGG 0: 1
1: 0
2: 5
3: 30
4: 238
Right 1054891800 9:70259331-70259353 AGCGCGCGGGCGTGGGCGTGTGG 0: 1
1: 0
2: 4
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054891793 Original CRISPR CCGCGCGCTGCCGGAGCCCC GGG (reversed) Intronic
900171897 1:1273468-1273490 CGGCGGGCTCCCGGAGCTCCGGG - Intronic
901447279 1:9316217-9316239 CCTGGGGGTGCCGGAGCCCCAGG - Intronic
901525860 1:9823388-9823410 GCGCGCGCTGCAGGCGTCCCGGG - Intronic
905406371 1:37735297-37735319 CCCATCCCTGCCGGAGCCCCTGG - Exonic
906069686 1:43007711-43007733 CCTGGAGCTGCCGCAGCCCCAGG - Intergenic
906524322 1:46485681-46485703 GCGCGCGCTGACGGCGGCCCCGG - Intergenic
908951401 1:69567468-69567490 CGCCGCGCTGCCCGAGCGCCCGG + Intergenic
912739649 1:112182338-112182360 CAGTGCCCTGCTGGAGCCCCGGG + Intergenic
912793498 1:112675290-112675312 TCCCGCGCTGCCCGCGCCCCCGG + Intronic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
922447435 1:225709248-225709270 CCGCTGGCTGCCGGAGCTACTGG - Intergenic
923631004 1:235649633-235649655 GGGCGCCCGGCCGGAGCCCCGGG - Intronic
924527238 1:244863613-244863635 TCACCCGCCGCCGGAGCCCCGGG + Exonic
1062938681 10:1406275-1406297 CAGCTCCCTGCCTGAGCCCCTGG - Intronic
1064230759 10:13528373-13528395 GCGCGCCCTCCCGGAGCCCCCGG - Intronic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1071977515 10:90969719-90969741 CCTGGTGCTGCCAGAGCCCCCGG + Intergenic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1075335859 10:121608686-121608708 CCGGGCGCTGCCCCAGCGCCAGG - Intergenic
1076626579 10:131824719-131824741 CTGAGCTCTGCCGGAGCCCTGGG - Intergenic
1076721969 10:132396833-132396855 CCCGCCGCGGCCGGAGCCCCGGG - Intergenic
1077052905 11:575848-575870 CCGCGCGCGGCGGGAGCACCTGG - Intergenic
1077107869 11:849761-849783 CCGCGCGGGGGCGGAGCCGCCGG + Intronic
1077361216 11:2140888-2140910 TCGCTCGCTGCCTGAGCTCCTGG - Exonic
1077889780 11:6410798-6410820 CCCAGGGCTGCCTGAGCCCCTGG - Exonic
1078390266 11:10931058-10931080 CGCCGCGCTGCCGGCGCCCCAGG - Intergenic
1079361997 11:19777273-19777295 CCGCGCGCAGCAGCGGCCCCGGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1082986156 11:59172567-59172589 CCGCGCAGCGCCGCAGCCCCGGG + Exonic
1083203553 11:61134066-61134088 CCACGAGCTTCCGGAGCTCCTGG + Exonic
1083472890 11:62896088-62896110 CCGCGCCCAGCTGGAGCACCTGG + Intergenic
1083672163 11:64305715-64305737 GACCGCGCTGCCGGAGCCCCAGG + Intronic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1084563873 11:69918858-69918880 GCGCGAGCTGCCTGATCCCCCGG - Intergenic
1084978156 11:72814464-72814486 CAGCGCGCTGCGGGGGCACCGGG - Exonic
1085332723 11:75667393-75667415 CCGCGGGCTGCCCGGGGCCCAGG - Intronic
1089398879 11:118153073-118153095 CCTCGCGGTCCCGGAGCCCCGGG + Intergenic
1089454047 11:118615509-118615531 CCTCCCGCTGACAGAGCCCCTGG - Intronic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1090190297 11:124762403-124762425 CCGCGCGCTGGGGGCGCCCCCGG - Intergenic
1090205307 11:124880505-124880527 CCTAGAGCTGCTGGAGCCCCTGG - Exonic
1090208731 11:124900363-124900385 CCTCGGGCTGCAGGAGCCTCTGG - Intergenic
1094219365 12:27975525-27975547 CTCGGCCCTGCCGGAGCCCCGGG + Intergenic
1096647710 12:53047514-53047536 CCGCGGCCAGCCAGAGCCCCCGG - Intronic
1097057377 12:56258127-56258149 GCGGGAGCTGCGGGAGCCCCGGG + Intronic
1097284281 12:57865505-57865527 CGGGGCGCTGCCAGAGGCCCCGG - Intergenic
1097891476 12:64781219-64781241 CCGCGTGCTGCAGGAGCTGCAGG + Intronic
1099365101 12:81758774-81758796 CCGCGTGCAGCTGGAGCCCCGGG + Intronic
1101253887 12:102958745-102958767 CCGCGCGCTGCAGCAGCTGCTGG + Exonic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1101640114 12:106581568-106581590 CCGCGCGCTGCCAGGGGCCCGGG + Intronic
1103320020 12:120087038-120087060 CCGAGAGCAGCGGGAGCCCCAGG - Intronic
1103779359 12:123389021-123389043 CCGCGCACCGCGGCAGCCCCGGG - Intronic
1103950714 12:124549551-124549573 CAGCGGGCTGAGGGAGCCCCAGG + Intronic
1105217448 13:18297507-18297529 CCGCGCACCGCGGCAGCCCCGGG - Intergenic
1105480769 13:20773589-20773611 CCACGCGCTGCCGTAGCCTGGGG + Intronic
1105557247 13:21459018-21459040 CCGCGCCCCGCCGCAGTCCCCGG + Intronic
1106411440 13:29514165-29514187 CCCCGAGCTGCCGCAGCCTCAGG - Exonic
1106422616 13:29595893-29595915 CCGCCCGCCGCGGGAACCCCAGG - Intergenic
1108648139 13:52450525-52450547 CCCCGCGCTGCTGGATCACCAGG + Exonic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1115651267 14:35404266-35404288 CGGGGCGGTGCAGGAGCCCCGGG + Intronic
1116886976 14:50231432-50231454 CGGCGGGCTGGCGGAGACCCCGG + Exonic
1117029455 14:51652721-51652743 CGGCGCGCTGGCGGAGCCCCAGG + Intronic
1117097626 14:52314368-52314390 CGGCGCGCGGCGGGAGACCCAGG + Intronic
1117690365 14:58299225-58299247 CCGGGAGCCGCCAGAGCCCCGGG - Intronic
1117920526 14:60722722-60722744 GCGCACGCTCCCGGATCCCCAGG - Intronic
1119236826 14:73026832-73026854 CCGAGGGCAGCCTGAGCCCCAGG + Intronic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122399315 14:101457949-101457971 TCGAGCGCCGCGGGAGCCCCAGG + Intergenic
1123042587 14:105496467-105496489 CAGCCCACTGCTGGAGCCCCAGG + Intronic
1123119371 14:105909728-105909750 CCCCGACCCGCCGGAGCCCCCGG + Intergenic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1125694155 15:41621511-41621533 CCTCGCGCTGCTGGACCACCCGG - Intronic
1127165754 15:56243741-56243763 CCCCGTGCTGCTGCAGCCCCAGG + Intergenic
1127608628 15:60615500-60615522 CCGGCTGCTGCTGGAGCCCCCGG - Intronic
1128425941 15:67542651-67542673 ACGCGCGGCGCCGGAACCCCGGG - Intergenic
1128992493 15:72272515-72272537 CCGCGCGCGGCCGCAGCCGACGG + Exonic
1129710749 15:77819275-77819297 CCGCGCGCGGACGGCGCGCCCGG - Intronic
1129919803 15:79310875-79310897 CTGCGCGCTCCCGGACCCGCAGG - Intergenic
1129933600 15:79431868-79431890 CAGAGCGCCGCCGGAGCCCCGGG - Intergenic
1131969270 15:97875750-97875772 CCGCGCGCAGCCGCGGCTCCCGG - Intergenic
1132056119 15:98650687-98650709 CCCCGCGCCGCCGCAGACCCTGG - Intronic
1132365081 15:101251430-101251452 CCGCGCGCGGCCGGCGCGCCTGG - Exonic
1132549376 16:548056-548078 CCGCGTCCTGCCCGAGCGCCCGG + Exonic
1132865434 16:2090730-2090752 CCGAGCTCTGCCAGAGCTCCTGG - Exonic
1133213101 16:4273775-4273797 CCCCTCCCTGCCGGGGCCCCCGG - Intergenic
1136098775 16:27978009-27978031 CCTCGCTCAGCCAGAGCCCCTGG - Intronic
1136365275 16:29806640-29806662 CCCCGCGCGGCCCGCGCCCCCGG + Exonic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1136517287 16:30775676-30775698 CAGCGCGCTGCAGGCGCCCCGGG + Exonic
1138591199 16:58000590-58000612 ACGCGCGCTGCCGGAGTAGCGGG + Intronic
1139664912 16:68448555-68448577 CCTCGCGCCGCCGGAGCCAATGG + Exonic
1139705632 16:68738416-68738438 GGGCGCGCTGCCGGTGTCCCTGG + Intronic
1139853792 16:69965474-69965496 GCGCGCGCTGCCCGAGGCCGGGG + Intergenic
1141683298 16:85556392-85556414 CCGCGCGGCGCCGGCGCGCCCGG + Intergenic
1142752850 17:1998685-1998707 GCTGGCGCTGCCGGAGCGCCCGG + Intronic
1142757596 17:2025092-2025114 CCGCGCGCTTGCTCAGCCCCGGG + Exonic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1146703284 17:34980734-34980756 CCGCCCGCCTGCGGAGCCCCGGG + Intronic
1147168713 17:38606107-38606129 CCGCGCGCTGCGGGATCACGCGG - Intergenic
1147341267 17:39754457-39754479 CCGCGCGCTGCAGATGCCCGCGG + Intergenic
1148048749 17:44759156-44759178 CCGCTGGCAGCCGCAGCCCCCGG + Exonic
1148059886 17:44829574-44829596 CCGCACGCCGCCGGAGACGCAGG + Intronic
1150266872 17:63837737-63837759 CAGAGCCCTGCTGGAGCCCCAGG + Intronic
1150699436 17:67434518-67434540 CCGCGCCCAGCCTGAGCTCCGGG - Intronic
1151727864 17:75894963-75894985 CCGCGCGCTGACCCCGCCCCGGG - Intronic
1151728224 17:75896641-75896663 CCGCGCGCTGCCCCCGCCACGGG - Exonic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1152601711 17:81265684-81265706 GTGGGCGCAGCCGGAGCCCCTGG + Intronic
1152751794 17:82065708-82065730 CCGGGAGCTGCAGGGGCCCCGGG - Intronic
1152861259 17:82698128-82698150 CTGCGCGCAGCGGGAGCCCGCGG - Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1159798223 18:72868195-72868217 CTGCGCGCGGCCGGCGCCCCGGG + Intergenic
1160662150 19:306197-306219 CCGCGGGCTGCCCCAGCCCTGGG - Exonic
1160873250 19:1286372-1286394 CCTCGCGCCCCCGGAGCTCCGGG + Intronic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161628423 19:5339773-5339795 CCGCACGCCCCGGGAGCCCCCGG - Intronic
1162019497 19:7862238-7862260 CCACGCGCTGCCGCAGCTCGCGG - Exonic
1162738128 19:12757909-12757931 CCCCGGCCTGCCGGAGCCCGAGG + Exonic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1165129090 19:33621380-33621402 CCGCGAGCTGCCTCAGGCCCGGG - Intergenic
1165300208 19:34963850-34963872 CTGCGCGCTCTCGGCGCCCCCGG - Exonic
1165493679 19:36140091-36140113 CCGGACGCTGCGGGAGGCCCGGG + Exonic
1165511927 19:36271083-36271105 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165512479 19:36273584-36273606 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165513026 19:36276125-36276147 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165513582 19:36278680-36278702 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165514132 19:36281214-36281236 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165514684 19:36283751-36283773 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165515236 19:36286284-36286306 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165515786 19:36288820-36288842 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165516337 19:36291357-36291379 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165516889 19:36293883-36293905 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165517442 19:36296406-36296428 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165517994 19:36298941-36298963 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165518545 19:36301476-36301498 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165519094 19:36304008-36304030 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165519644 19:36306523-36306545 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166497841 19:43317021-43317043 CCGCCCGTTGCGGCAGCCCCAGG - Intergenic
1167291652 19:48628229-48628251 CAGCGCGTTGCCCGAGCCGCAGG - Exonic
1167613484 19:50518309-50518331 CCCGCCGCTGCCGGTGCCCCCGG + Exonic
1167752548 19:51389388-51389410 CCACGCTCTCCGGGAGCCCCAGG + Exonic
927943995 2:27123788-27123810 CCGCCCACCGCCGGTGCCCCGGG - Intronic
929107192 2:38376960-38376982 CCGCGCGCTGCGGGAGCGCGGGG + Intronic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
934296871 2:91749176-91749198 CCGCGCACCGCGGCAGCCCCAGG + Intergenic
934661320 2:96145114-96145136 CCGCGCGCTGCGGACGCGCCTGG - Exonic
934670326 2:96208455-96208477 CCGCGAGCTTCCGGGGCCCAAGG + Exonic
935555169 2:104502109-104502131 CCGCGCGCTGCCCGCTCCTCGGG + Intergenic
936433204 2:112482063-112482085 CCGCGCTCTGGAGGAGCCCGTGG - Intergenic
937997075 2:127702094-127702116 CAGCGCGGTGCCGCCGCCCCAGG - Exonic
938248744 2:129797853-129797875 CCCCGAGCTGCTGGAGGCCCCGG - Intergenic
940640869 2:156342761-156342783 CCGAGTGCTGCCGGGGCCCCGGG + Intergenic
941951575 2:171161120-171161142 CCGCGCGGCGCGGGAGCCCGGGG + Intronic
942947033 2:181683190-181683212 CGTCGCGATGCCGGCGCCCCGGG - Intergenic
946161734 2:217839838-217839860 CCCCTCGCTTCTGGAGCCCCAGG - Intronic
946351871 2:219160596-219160618 GCGCGCGCTGCCGGGGTCCAGGG - Intronic
947549659 2:231037441-231037463 CCGAGCCCAGCCGGACCCCCGGG - Intergenic
947724064 2:232386655-232386677 CCGCCAGCTGCCGTAGACCCGGG - Intergenic
948525148 2:238566839-238566861 CCGGGGGCTTCAGGAGCCCCAGG - Intergenic
948694736 2:239727488-239727510 CCTCTGGCTGCCTGAGCCCCTGG + Intergenic
1169065625 20:2692960-2692982 CCCGGCCCTGCCGTAGCCCCGGG - Exonic
1169195990 20:3682186-3682208 GCGCGCGCCGTCGGGGCCCCTGG - Exonic
1171011275 20:21510707-21510729 TCGCGCGCTGTCTGAACCCCGGG - Intergenic
1172966004 20:38835857-38835879 CCCCGCGCTGCCCTGGCCCCCGG + Exonic
1173690881 20:44960213-44960235 CCGCGCGCTGCGGGTGCTGCAGG - Exonic
1173815621 20:45985927-45985949 CAGCGCCCTGCTGAAGCCCCTGG - Intergenic
1174204338 20:48828018-48828040 CCGCGCGCTGCCTCCGCCCCCGG - Intergenic
1175121097 20:56716927-56716949 CCTCTCCCTGCTGGAGCCCCAGG + Intergenic
1175367717 20:58467216-58467238 CCGCCTGCAGCCGCAGCCCCGGG - Exonic
1176119971 20:63450005-63450027 CCCTGCGCTGCCTGCGCCCCTGG + Intronic
1176555783 21:8253474-8253496 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176574720 21:8436508-8436530 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176611334 21:8987801-8987823 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176705941 21:10120021-10120043 CGTCGAGATGCCGGAGCCCCCGG - Intergenic
1178555648 21:33588326-33588348 CCGCGAGCAGCCGGAGGCCCCGG - Exonic
1178707679 21:34888946-34888968 CCGCACGCGGGCGGGGCCCCGGG - Intronic
1179893750 21:44350435-44350457 CCGCGCCCTGCAGCAGCACCGGG - Intronic
1180162828 21:46005951-46005973 CCGCTCGCTGCCTCTGCCCCGGG - Intergenic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1181057871 22:20268383-20268405 CCGCGCGGCGCCGGTGCACCGGG - Exonic
1181079702 22:20405732-20405754 CCCCGCGCTGCCGGCGCACCTGG - Exonic
1183546259 22:38455979-38456001 CCGCGGGCAGCCGGGGCTCCCGG - Intergenic
1183683672 22:39349906-39349928 GCGCGCGCGGCCGGCGGCCCAGG - Intronic
1183811313 22:40260040-40260062 CCGCACTCTGCCGGACCCTCTGG - Intronic
1184086630 22:42269908-42269930 GCGAGCGCGGCCGGTGCCCCCGG + Intronic
1184711219 22:46250493-46250515 CCGTGCGCTGCGGGAGCGCGCGG + Exonic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
1184881376 22:47306524-47306546 CCGCGCCCGGCCAGAACCCCCGG - Intergenic
1185068151 22:48642232-48642254 CCCAGCCCTGCCAGAGCCCCAGG + Intronic
1203252768 22_KI270733v1_random:125559-125581 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203260824 22_KI270733v1_random:170645-170667 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
950467818 3:13165737-13165759 CCCCTCGCTGCTGCAGCCCCAGG + Intergenic
952942360 3:38454284-38454306 CCGCGCACACCCGGAGCCCGCGG - Exonic
954076867 3:48188032-48188054 CCGCGCGCCACCGGCGCCCGCGG + Exonic
958034034 3:88149606-88149628 CCGCCCGCTGGCCGGGCCCCCGG - Intronic
966888844 3:184391662-184391684 CCAGGCCCTGCCTGAGCCCCAGG + Intronic
966913006 3:184569620-184569642 CCTCCCGCTGCCGCAGCCCCTGG - Intronic
969476921 4:7427130-7427152 CCTGGCGCAGCCGGAGCTCCAGG + Intronic
969488375 4:7485181-7485203 CCGAAGGCTGCAGGAGCCCCAGG - Intronic
970397287 4:15681690-15681712 CCGCCCGCTCCCGGCACCCCCGG + Intronic
970637104 4:18021668-18021690 CCGCTCAGTGCCGGAGCCCTCGG - Exonic
975148227 4:70993460-70993482 CCGCGCCCTGCCCGGGCGCCTGG + Exonic
975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG + Intergenic
980354444 4:131724521-131724543 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980354977 4:131727027-131727049 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980355525 4:131729514-131729536 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980356066 4:131732005-131732027 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980360913 4:131754364-131754386 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980361996 4:131759319-131759341 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980363081 4:131764281-131764303 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980378202 4:131976707-131976729 CGTCGGGATGCCGGAGCCCCCGG - Intergenic
987099734 5:14581658-14581680 CCGCGCGCTGTCGGGGTCGCGGG - Intergenic
987193253 5:15500388-15500410 CCGCGCACAGCCCGCGCCCCGGG - Exonic
990557514 5:56951484-56951506 CCGGGAGGTGCGGGAGCCCCTGG - Intronic
994043499 5:95284254-95284276 CTGCTCGTCGCCGGAGCCCCTGG - Exonic
997583978 5:135034036-135034058 CCGCCCGGCGCCGCAGCCCCGGG - Exonic
1002409172 5:179060603-179060625 CCGCTCGCGGACGGCGCCCCGGG - Exonic
1003624154 6:7727267-7727289 CCTCCTGCTGCCGGAGCGCCGGG - Exonic
1003911490 6:10747767-10747789 CCCCGCCCTGCCGCGGCCCCGGG + Exonic
1007557903 6:42782435-42782457 CCCAGCGCTGCCGGGGCCCCGGG + Intronic
1007584213 6:42978898-42978920 CCGCGCGCTGCTGCGGCTCCTGG - Exonic
1013170792 6:107634942-107634964 CCGCCCGCCGCCGGCGACCCAGG + Exonic
1013627536 6:111952554-111952576 CCGCTCCCTGGCAGAGCCCCTGG - Intergenic
1013980344 6:116121298-116121320 CCAGGAGCTGCTGGAGCCCCAGG - Exonic
1014944052 6:127475953-127475975 CCGCGCGCTGTCGTGGCCGCCGG + Exonic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1019660903 7:2223513-2223535 CCAAGCACTCCCGGAGCCCCGGG + Intronic
1019716997 7:2543697-2543719 TCGGGCGCTGCCAGAGCCCCTGG - Exonic
1019765101 7:2844179-2844201 CCGCGCCCCGCCGGCGCCCGGGG + Exonic
1020275498 7:6622270-6622292 ACGACCGCGGCCGGAGCCCCCGG - Exonic
1020281752 7:6653483-6653505 GCGCCCGCTCCCGGCGCCCCTGG + Exonic
1023856866 7:44189389-44189411 CCGAGCGGCGCCTGAGCCCCAGG - Intronic
1026471138 7:70694684-70694706 CCGCGCGCCGCAGGAGCGGCGGG + Intronic
1026523060 7:71132742-71132764 CCGCGCCTCGCCGGAGCCCGAGG + Exonic
1029074945 7:97928036-97928058 CCCCGCGCTCCCGGCACCCCCGG + Intergenic
1029461069 7:100694133-100694155 CCGCGCGCCGCCCACGCCCCGGG - Intergenic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1034781636 7:153887212-153887234 CCGCCTGCTGGAGGAGCCCCCGG + Intronic
1035580964 8:738725-738747 CCGCGCGCTGAGGGAGGGCCGGG - Intergenic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1037116705 8:15236908-15236930 CCGCCCCCTGCCCGAGTCCCCGG + Intronic
1038008709 8:23457309-23457331 CGGCGCGCTCCCCCAGCCCCTGG - Intronic
1038406475 8:27326072-27326094 CCGGGCCCTTCCGCAGCCCCAGG + Intronic
1041689900 8:60678705-60678727 CCGCGCGCACCCGAAGCCGCGGG - Intergenic
1045305418 8:100952701-100952723 CCGCGCCCTGCCCCCGCCCCGGG - Intronic
1049557614 8:143291004-143291026 CCGCGTGCTGCCACAGCCCCGGG + Intronic
1053482317 9:38424567-38424589 CCGCGCGGTGCCCGCGGCCCGGG + Intergenic
1053643221 9:40107139-40107161 CGTCGAGATGCCGGAGCCCCCGG - Intergenic
1053762929 9:41358351-41358373 CGTCGAGATGCCGGAGCCCCCGG + Intergenic
1054324074 9:63704367-63704389 CGTCGAGATGCCGGAGCCCCCGG - Intergenic
1054541534 9:66269464-66269486 CGTCGAGATGCCGGAGCCCCCGG + Intergenic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1058908566 9:109499954-109499976 CCGGGCGGGGCCGGAGCCCCCGG + Intergenic
1061208696 9:129178475-129178497 CCGCGCGGCGCGGCAGCCCCAGG - Intergenic
1062022627 9:134326586-134326608 CCGCCCGCTGCCTGCGCCGCCGG + Exonic
1062186698 9:135222163-135222185 CTGCGAGCTGCCGGTGCCTCAGG - Intergenic
1062230772 9:135480244-135480266 CCCCGCGCTCCTGGAGCCCCAGG + Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1203469171 Un_GL000220v1:108710-108732 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203476992 Un_GL000220v1:152682-152704 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1186466310 X:9786563-9786585 CCGCGCGCGGCCCGAGCGCCTGG + Exonic
1189332836 X:40153787-40153809 CCCCGCGCGGCCGGAGGCTCGGG + Intronic
1189407248 X:40735889-40735911 CCGCGCGCCGCCGGAAACCAGGG + Intergenic
1192814223 X:74574242-74574264 CCGCGCCCAGCCAGAGTCCCTGG + Intergenic
1198750138 X:139931509-139931531 CCGCCCGCTGGCTGAGCCCTAGG + Intronic
1200233714 X:154458478-154458500 CCCCGGGCTGCCGGAGCCCCGGG - Intronic
1200306069 X:155027084-155027106 GCGCGCGCGGCCGGCGCCGCGGG + Intronic