ID: 1054894412

View in Genome Browser
Species Human (GRCh38)
Location 9:70292034-70292056
Sequence AAGCTGTTATTCAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 1, 2: 4, 3: 76, 4: 505}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054894412_1054894414 0 Left 1054894412 9:70292034-70292056 CCATTTTTCTTGAATAACAGCTT 0: 1
1: 1
2: 4
3: 76
4: 505
Right 1054894414 9:70292057-70292079 CCCAGATTGTTACAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054894412 Original CRISPR AAGCTGTTATTCAAGAAAAA TGG (reversed) Intronic
904105260 1:28075670-28075692 GAGCATTTATTCAAGAGAAATGG - Intronic
904916927 1:33977013-33977035 AGGCTGTTATTCAAGCAAAGAGG + Intronic
905327687 1:37169402-37169424 GAGTGTTTATTCAAGAAAAATGG - Intergenic
907096337 1:51784632-51784654 AAGCTGTAGTTCAAGACAAAAGG - Intronic
907340270 1:53730532-53730554 AACCTGTTATTTAAAAACAAAGG + Intronic
907921540 1:58918874-58918896 AAGCTGAGATTCAAAAAAAGAGG + Intergenic
908216874 1:61963080-61963102 AGTCTATTATTCAAGAGAAAAGG + Intronic
908243379 1:62207614-62207636 AATATGGAATTCAAGAAAAAAGG + Exonic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
909809603 1:79916325-79916347 AAGCTATTAATCAAGAAATCTGG - Intergenic
909905952 1:81194934-81194956 AAGCTGTAATACTAGAAATATGG - Intergenic
910145006 1:84069511-84069533 AATGGGTTGTTCAAGAAAAAGGG - Intergenic
910527159 1:88193330-88193352 AAGCTATTTTTCAGGAAAGAGGG + Intergenic
910535007 1:88287736-88287758 ATTCTGTTTTTCTAGAAAAAAGG + Intergenic
911451027 1:98061092-98061114 AAGCTTTTATGCAAAAAAATAGG + Intergenic
911451389 1:98066295-98066317 AAACTATTTTACAAGAAAAATGG - Intergenic
912049480 1:105507806-105507828 AAGCTTTTATACGAGAGAAAAGG - Intergenic
914354009 1:146866271-146866293 GAGTATTTATTCAAGAAAAATGG + Intergenic
914619622 1:149392554-149392576 AAGCTTTCATTCAAAGAAAAAGG - Intergenic
916298534 1:163247700-163247722 AACCTTTTCTTCTAGAAAAATGG + Intronic
916772222 1:167921534-167921556 ATGCTGATGTTAAAGAAAAATGG - Intronic
917148478 1:171918995-171919017 AATATTTTCTTCAAGAAAAAAGG - Intronic
917690566 1:177463990-177464012 AAACTATTATACAAGAAGAAAGG - Intergenic
917875524 1:179283288-179283310 ATTCTGTTACTAAAGAAAAAGGG + Intergenic
918579785 1:186112473-186112495 AACCTGTGATTCTAGGAAAAAGG + Intronic
918838900 1:189507764-189507786 AAGGTGTTATTTAAGAATACTGG - Intergenic
918892844 1:190297611-190297633 TACCTGTTCTTCCAGAAAAAAGG - Intronic
919357729 1:196546777-196546799 AAGATATTATTGAAGAAAATTGG + Intronic
920904005 1:210142323-210142345 GAGTGTTTATTCAAGAAAAATGG - Intronic
921252174 1:213308354-213308376 AATCTGTTTCTAAAGAAAAATGG + Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
922636031 1:227172311-227172333 AAGCTATTATTTAAGAATTATGG + Intronic
922995791 1:229959310-229959332 AAGATACTGTTCAAGAAAAATGG - Intergenic
923346182 1:233055163-233055185 AAGCATTTACTCAAGAGAAATGG - Intronic
924820634 1:247487135-247487157 CAGCTGATATTCAAGAAAATTGG + Intergenic
1063895965 10:10682350-10682372 AAATTGTTCTTTAAGAAAAACGG - Intergenic
1064326422 10:14355500-14355522 AAGATTTTATTCAAGTCAAAAGG - Intronic
1064879898 10:20039416-20039438 AAGCTGGTATTCGAAAGAAAAGG + Intronic
1065635797 10:27732464-27732486 AAACAGTTATTAAACAAAAAAGG - Intronic
1066203871 10:33168072-33168094 AGGATGTTATTCAACAATAAAGG - Intergenic
1067377200 10:45738608-45738630 AAGCTGTTAGACTAGGAAAAGGG + Intronic
1067823067 10:49547928-49547950 AAGATGTTTTTCTGGAAAAAAGG - Intergenic
1067884908 10:50079300-50079322 AAGCTGTTAGACTAGGAAAAGGG + Intronic
1068311423 10:55281539-55281561 AAGCCTTTATTCAATAAAAAGGG - Intronic
1068371470 10:56121754-56121776 ATGCTTTTATTCAATAACAAAGG - Intergenic
1069643830 10:69976954-69976976 GAGCATTTATTCAAGAAAACTGG + Intergenic
1070061093 10:72983685-72983707 AAGCTGTTCTTCAAAAATGAGGG - Intergenic
1070387009 10:75934821-75934843 AAACTGTTCTAAAAGAAAAAGGG - Intronic
1070738669 10:78886341-78886363 AAGATGTCATTCAAGAATAGAGG + Intergenic
1071163172 10:82776166-82776188 AAGCTGTTCTTCAAAAATGAAGG - Intronic
1071197548 10:83178581-83178603 AAGATGTTATTCACCAGAAATGG + Intergenic
1071865945 10:89731869-89731891 AATGGGTTATTTAAGAAAAAAGG - Intronic
1073165453 10:101445191-101445213 ATTCTGTTTTTCAAGAATAATGG + Intronic
1074825322 10:117210699-117210721 ATGCAGTCATTCAAGAAAAGAGG - Intergenic
1075433423 10:122410715-122410737 ATACTGTAATTTAAGAAAAATGG + Intronic
1076093099 10:127706001-127706023 AAGATGCTATACCAGAAAAATGG + Intergenic
1076394603 10:130129551-130129573 AAAGTGTTATTCGAGTAAAATGG - Intergenic
1077922423 11:6651475-6651497 AAGATTTTGTTCAAGGAAAATGG + Intronic
1078658639 11:13266190-13266212 AAACTTTTATTCAGGAAAATGGG + Intergenic
1079387271 11:19991537-19991559 AAGCTGTTATAGAAATAAAAGGG - Intronic
1081494149 11:43589764-43589786 AACCTGTTGGTCAAGAACAATGG + Intronic
1081555877 11:44160505-44160527 AAGATGGCATTCCAGAAAAAGGG + Intronic
1082636020 11:55595398-55595420 AATCTGTTCTTCAGAAAAAAAGG - Intergenic
1082878411 11:58012567-58012589 AAACTATTATTCAAGAAAGAGGG + Intergenic
1082902311 11:58268113-58268135 AAGATACTATTGAAGAAAAATGG + Exonic
1083136353 11:60680565-60680587 AAGCATTTATTCAAGTTAAATGG + Intergenic
1084032801 11:66491220-66491242 AAGGTGTCATTCAAGAGAAAAGG - Intronic
1084812439 11:71621928-71621950 AAACTCTGATTCAAAAAAAAAGG - Intergenic
1086915018 11:92519983-92520005 AAGTTATTATTCAAGAGTAATGG + Intronic
1087322693 11:96682995-96683017 GAACATTTATTCAAGAAAAATGG + Intergenic
1087392103 11:97549200-97549222 AAGCTGTTTTTTAAAAAAAAAGG + Intergenic
1087503570 11:98992001-98992023 AAGCTACTATTCAAAAATAAAGG - Intergenic
1092576668 12:9791373-9791395 AAGCATTTACTCAAGAAAATAGG - Intergenic
1093760667 12:22905736-22905758 AAGCTGTCATTCAAAAATGAGGG + Intergenic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1094331719 12:29301428-29301450 AAGCTGTTATTCTGGAAAACTGG - Intronic
1094669048 12:32550969-32550991 AATCTCTTATTCAACAAAGATGG - Intronic
1095226907 12:39688008-39688030 AAACATTTATTGAAGAAAAAAGG - Intronic
1095398588 12:41789414-41789436 AACCTTCTATTGAAGAAAAATGG + Intergenic
1095604290 12:44048495-44048517 AAGCTGTTATTAAAGTATATAGG - Intronic
1095718805 12:45377733-45377755 AGGCTGTTATTCAAGCCCAATGG + Intronic
1095979744 12:47964758-47964780 AAGCTGCTTTTCAAGGAAATGGG + Intronic
1096016867 12:48284309-48284331 TAGCTGCTATTTAAGAAATAAGG - Intergenic
1097313481 12:58147417-58147439 AAGTGTTTATTCAAGAAAAGTGG - Intergenic
1097403339 12:59157186-59157208 AAGCCCACATTCAAGAAAAAAGG + Intergenic
1098117509 12:67195640-67195662 AAGGTGTTGGTCAGGAAAAATGG + Intergenic
1098506121 12:71252717-71252739 AAACTGTTTTTCAATAATAAAGG + Intronic
1098808270 12:75049919-75049941 AAGCAGTTATTTAAGAAGAATGG - Intronic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099306606 12:80964476-80964498 CAGCTTTTATGCAAGAAAAATGG - Intronic
1099319582 12:81129420-81129442 TTGCTGTTATTCAAGAACACAGG + Intronic
1099371730 12:81840301-81840323 AATCTGTTATTCTATAAAACTGG + Intergenic
1099396185 12:82143826-82143848 AAGCATTTATTCCAGAAAAAGGG + Intergenic
1100082970 12:90875618-90875640 AAGCTGTTCTTCTGGCAAAAAGG - Intergenic
1100462398 12:94813705-94813727 AAACTATCATTCAAGAATAAAGG + Intergenic
1100910043 12:99349563-99349585 AAGTTGTTATAAAAGAAAAAGGG + Intronic
1100935614 12:99661703-99661725 AAGGTGTTACTAAAGACAAAAGG - Intronic
1102182887 12:110925493-110925515 AAGCTTAAATTCAAGAAAAGTGG + Intergenic
1104488557 12:129173969-129173991 AAGTTGTGGTTCAAGAAAAGAGG + Intronic
1104900030 12:132184626-132184648 AAGCTGGTAATCCAGAAACAAGG - Intergenic
1105617941 13:22037609-22037631 AAGCAAGTATTCAAGAATAAAGG - Intergenic
1105675016 13:22661770-22661792 ATGTTGTCTTTCAAGAAAAAGGG + Intergenic
1106045539 13:26136904-26136926 GAGCTTTTATTCAAGAAAAACGG + Intronic
1106306690 13:28517648-28517670 AAGATGTTATTCAAGTAGAAAGG + Intergenic
1106485526 13:30168990-30169012 AAGCTTTTATTTAATTAAAATGG + Intergenic
1107121946 13:36805616-36805638 GAGCTCTTCTGCAAGAAAAATGG + Intergenic
1107134517 13:36929262-36929284 TAGCTGCTATTCAAAAAGAATGG - Intergenic
1107306616 13:39027521-39027543 AAGGTTTTAGTCAAGAAAACTGG + Intronic
1107775669 13:43838474-43838496 AAGCTGTTTTTTAAGAAGATTGG - Intronic
1108417464 13:50213101-50213123 GAGCATTTATTCAAGAAAAATGG + Intronic
1108439852 13:50440063-50440085 AAGCTGTTCTTTAAGAAGGAAGG - Intronic
1109111464 13:58325718-58325740 AAGCAGTTATAGCAGAAAAAAGG - Intergenic
1109664040 13:65506308-65506330 AGGCATTCATTCAAGAAAAATGG - Intergenic
1109796895 13:67326992-67327014 AAGTTGTTATTAGAGGAAAATGG - Intergenic
1110868916 13:80427780-80427802 AAACAGGAATTCAAGAAAAAGGG + Intergenic
1110962972 13:81653860-81653882 AATCTGTCATTCCAGAGAAAGGG - Intergenic
1111227766 13:85296609-85296631 AAGCTGTTATTTTGGAAAATAGG - Intergenic
1111930382 13:94506834-94506856 ATCCTGTTATTCACTAAAAAGGG + Intergenic
1112321870 13:98415217-98415239 AAGCTCTGATTCAAGAGAACTGG - Intronic
1112561384 13:100517765-100517787 AAGCAGTAATTCAAGAGAAAAGG - Intronic
1112614976 13:100995039-100995061 AACCTATCATTCAAGAACAAAGG + Intergenic
1112700546 13:102002585-102002607 AAACTGTTCTTCAAGTAAAAGGG - Intronic
1113162209 13:107394603-107394625 AATCTGTTTTTCAAATAAAAAGG + Intronic
1113401151 13:109994503-109994525 TAGCTGCTTTTCAACAAAAAAGG + Intergenic
1114757725 14:25279195-25279217 AAACTGTTATTCAAATAAAAGGG + Intergenic
1115516306 14:34188569-34188591 AAGTAGTTATTCAATTAAAATGG - Intronic
1115860778 14:37683887-37683909 ATGCTGTGGTTCAAGGAAAAGGG - Intronic
1116869078 14:50054752-50054774 AAGCAGTTACTGAAGGAAAATGG + Intergenic
1117197836 14:53359216-53359238 AATCTGTTATTGGAGAGAAAAGG + Intergenic
1117704992 14:58456266-58456288 GAGCATTTATTCAAGAAAAATGG - Intronic
1118121625 14:62851122-62851144 AAGCTATTATTTTAAAAAAATGG + Intronic
1118188983 14:63563530-63563552 GAGCATTTATTCGAGAAAAATGG + Intergenic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1119455684 14:74753586-74753608 AATCTGTTATTAAAGGAAGAAGG - Intergenic
1119565693 14:75627387-75627409 CAGCATTTATTCAAGAGAAATGG + Intronic
1119606102 14:76019330-76019352 AAGCTATTATTCAAAAATGAAGG - Intronic
1119908682 14:78329528-78329550 AAGCTGTTAATGAAGCCAAAAGG - Intronic
1119924243 14:78476865-78476887 AAGGTGTTATGGAAGATAAATGG - Intronic
1119981649 14:79088269-79088291 AAGCTGATCTTCAAGGAGAAGGG - Intronic
1120077022 14:80170430-80170452 TAGATGTTATTCAAGCAAAGTGG - Intergenic
1120429021 14:84390443-84390465 AATATGTTATTCAAGGTAAATGG - Intergenic
1120657118 14:87204426-87204448 AAGCTTTTCTTAAAGTAAAATGG + Intergenic
1122567561 14:102671661-102671683 AAGCTGTTATTTAAAAAGCAAGG - Intronic
1122619114 14:103043669-103043691 AAGCTGTTACAAAAAAAAAAAGG + Intronic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1123114452 14:105888226-105888248 AAACTGGTATTCAAGATCAATGG - Intergenic
1123166743 14:106332582-106332604 AAGCAGTTCTTCAAAAAGAATGG + Intergenic
1123169426 14:106357629-106357651 AAGCAGTTCTTCAAAAAGAATGG + Intergenic
1123899941 15:24866236-24866258 TATCTGTTATTTAATAAAAATGG - Intronic
1124009382 15:25824755-25824777 AAACATTTATTCAAGAAAAATGG + Intronic
1124698790 15:31893039-31893061 AAGCAGTAAGGCAAGAAAAATGG + Intergenic
1124930024 15:34110444-34110466 AAGCTGTTTTTCAAAATAAAGGG + Intergenic
1125069467 15:35534494-35534516 AAGTTGTTATTAAAAAACAATGG + Intronic
1125738925 15:41947948-41947970 CAGCTGCTAGTCAAGAACAATGG + Intronic
1126426393 15:48531109-48531131 TAGCTGTGATTTGAGAAAAAAGG - Intronic
1127346387 15:58104899-58104921 AAGCATTTATTTAAGAAAAATGG - Intronic
1127394274 15:58530998-58531020 AAGCGTTTACTCAAGAGAAATGG - Intronic
1128430856 15:67591804-67591826 AAGTCCTTATTGAAGAAAAATGG - Intronic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129380107 15:75159344-75159366 AAGCTGCTAATAAAGAATAAAGG - Intergenic
1130436804 15:83908517-83908539 AAACTGTTATTCAAATACAAAGG - Intronic
1130524057 15:84688563-84688585 AAGCTGTTGTTATAGAAAACCGG - Intronic
1131895082 15:97019401-97019423 AAGCTGTTAAACAAGAGAATTGG + Intergenic
1131913133 15:97231104-97231126 AAGCAATTATTAAAAAAAAACGG + Intergenic
1132265735 15:100469083-100469105 AAGCTGTTAATCACAAAGAAAGG + Intronic
1133416200 16:5609025-5609047 TAGCTTTTAATCAAGAAAGACGG + Intergenic
1138781489 16:59793779-59793801 AACCTGACATTCAAGAAAATGGG - Intergenic
1139129482 16:64123825-64123847 AATCTGGTATTCAGGAAAAATGG + Intergenic
1139266979 16:65649135-65649157 AAGCAGTTCTTCAAAACAAAAGG + Intergenic
1139980010 16:70849251-70849273 GAGTATTTATTCAAGAAAAATGG - Intronic
1140160676 16:72489347-72489369 AAGGTATTATTCAAGAATAAGGG - Intergenic
1140422014 16:74827339-74827361 AAGCATTTATTCAAGAAAAATGG + Intergenic
1140713809 16:77703506-77703528 ATTCTGTCTTTCAAGAAAAATGG + Intergenic
1141225341 16:82109681-82109703 GGACTGTTATTGAAGAAAAATGG + Intergenic
1143361904 17:6377899-6377921 AGGCAGTTCTTCAAGATAAAGGG - Intergenic
1143800801 17:9378932-9378954 AAGCTGTCATTCAAGTATAAAGG + Intronic
1144380517 17:14692663-14692685 AAGCTGTTCTTCAGAAATAAAGG - Intergenic
1146233710 17:31136940-31136962 AAACTATCATTCAAGAATAAGGG - Intronic
1147009994 17:37437879-37437901 AAGCTGTTGTTGAAGAGTAAAGG + Intronic
1147282694 17:39375729-39375751 GAGTTTTCATTCAAGAAAAACGG + Intronic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1149001001 17:51757402-51757424 AAGCTCTTATTCAATAAACCAGG + Intronic
1149164129 17:53729586-53729608 AAACTGTAATAAAAGAAAAAAGG + Intergenic
1149405547 17:56346570-56346592 ATGTCTTTATTCAAGAAAAATGG - Intronic
1149423368 17:56531861-56531883 AAGCTGGTATTTAAAAAAAGAGG - Intergenic
1150051333 17:61966939-61966961 AAGCTTTTATTCAAACAAAATGG - Intronic
1151978273 17:77494568-77494590 AAGCTGTTGCTCTAAAAAAATGG + Intronic
1152822229 17:82443255-82443277 AAGCTGTGAGGCCAGAAAAAAGG - Exonic
1153449153 18:5207471-5207493 AAACTGTTTTTCAAGAACAGTGG - Intergenic
1154336735 18:13471809-13471831 ACACTGTTCTTCAAGAAAAATGG - Intronic
1157836407 18:50907342-50907364 GAGCAGTTATTCAGGAAAAATGG - Intronic
1157938572 18:51900242-51900264 AAGCTAATATTGAAGATAAAAGG - Intergenic
1158486594 18:57872061-57872083 AAGCACTTATTTAAGAAAAATGG + Intergenic
1158569595 18:58586430-58586452 GAGCCTTTATTCGAGAAAAATGG + Intronic
1158997250 18:62934831-62934853 AAGCTGTTAATAAAAAAATAAGG + Intronic
1159422321 18:68238242-68238264 AAGTTGTTAATGAAAAAAAATGG + Intergenic
1159762813 18:72449596-72449618 GAGCTGCTATTTAAGAAAGAAGG - Intergenic
1159940978 18:74408272-74408294 AAGCTGTCATGCTAAAAAAAAGG + Intergenic
1160094809 18:75861722-75861744 AAGGAGTTTTTCAAGTAAAAAGG + Intergenic
1162570300 19:11467794-11467816 TAGCTTTTATTTTAGAAAAAGGG + Intronic
1163539390 19:17898283-17898305 AAAATGTTACCCAAGAAAAAGGG - Intergenic
1164567894 19:29341229-29341251 GAGCATTTATTCAATAAAAATGG + Intergenic
1165531723 19:36408371-36408393 AATCTGTTCTTTAAGAAGAAAGG - Intronic
1165577342 19:36832071-36832093 AAGCTGTCATTCGAGTATAAAGG + Intronic
1165654005 19:37517155-37517177 AATCTGTTTTTAAATAAAAAAGG + Intronic
1167179660 19:47893024-47893046 AAGCTGTTATTCAGACAAAGAGG + Intergenic
1167515907 19:49923074-49923096 CAGCTCTTATGCAAAAAAAAAGG - Intronic
926257002 2:11212974-11212996 ATGCTGTTAATAAAGAATAAAGG - Intronic
926272440 2:11376797-11376819 AAGCTGTTATTAAAAAACAATGG + Intergenic
927436148 2:23068241-23068263 AAGCTGTGACTCTAGAAAGAAGG - Intergenic
927445074 2:23152973-23152995 AAACTATTATTCTAGAGAAAAGG + Intergenic
928498563 2:31862647-31862669 AAGCTAGTATACAAGTAAAATGG - Intergenic
928698577 2:33875747-33875769 AAACTTTTATTAAAAAAAAATGG - Intergenic
929616134 2:43309799-43309821 GAGCAATTAGTCAAGAAAAAAGG + Intronic
930690130 2:54353605-54353627 GAGCATTTATTCAAGAAAAATGG - Intronic
931207635 2:60163584-60163606 AAGCTGTGATACAAAAAGAAAGG - Intergenic
931736338 2:65198284-65198306 ATGCTGTTTTCCCAGAAAAATGG - Intergenic
931973987 2:67622696-67622718 AAGCTGTTATTAATGCAAATTGG + Intergenic
932325501 2:70857328-70857350 GAGCAATTAGTCAAGAAAAAGGG - Intergenic
932649142 2:73536844-73536866 GAGTATTTATTCAAGAAAAATGG + Intronic
932693474 2:73933622-73933644 AAACAGTTTTTCATGAAAAAAGG + Intronic
932919544 2:75894902-75894924 GAGCGTTTATTCAAGAAATATGG - Intergenic
933000678 2:76918676-76918698 AGGCTGTTATTAAGAAAAAAAGG - Intronic
933187788 2:79298181-79298203 AAGCTTTTATTCATGGCAAAAGG + Intronic
933876868 2:86628665-86628687 AAGATGTAATTCAACAAATAGGG - Intronic
934517189 2:94995961-94995983 AAGCAGTTTTTAAAGACAAAAGG + Intergenic
934944282 2:98526629-98526651 TAGCATTTATTTAAGAAAAATGG + Intronic
935532104 2:104246844-104246866 AGGCTGATATTCAAGAATTAAGG + Intergenic
935757224 2:106285480-106285502 AAGCTGTCCTTCAAGTATAAAGG + Intergenic
935930707 2:108121641-108121663 AAAATATTATTCAAGAACAAAGG + Intergenic
936803280 2:116293064-116293086 GAACTGTTATTCAGAAAAAAGGG - Intergenic
936838498 2:116739744-116739766 AAGCTGTAATTGAAGAGTAATGG + Intergenic
936853808 2:116933510-116933532 AAGCAGCTATTCAAACAAAAGGG + Intergenic
937112887 2:119380249-119380271 AAGATGTTAAAAAAGAAAAAGGG - Intergenic
937764913 2:125649717-125649739 AAGTTTTTATTCAAGAAAAATGG - Intergenic
938660025 2:133476885-133476907 AAGCTGTTCTGAAAGAAAAGAGG - Intronic
938953272 2:136276791-136276813 AGTCTCTTATTCAAGAATAAAGG - Intergenic
939137939 2:138319170-138319192 AAGCTGATACTGACGAAAAAGGG + Intergenic
939361553 2:141178834-141178856 AAGGAGTTATTCAAGAATCAAGG - Intronic
939427895 2:142063998-142064020 AGGATATTATTCAATAAAAATGG - Intronic
939693622 2:145296691-145296713 GAGCTGTTATTCATGACAAAGGG + Intergenic
939706074 2:145455430-145455452 AAGTGGTTATTAAAAAAAAATGG - Intergenic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
940411740 2:153372291-153372313 AAGCTTTTTTCCTAGAAAAATGG - Intergenic
940469451 2:154076649-154076671 TAGCATTTATCCAAGAAAAAGGG - Intronic
941185442 2:162316995-162317017 AAACTTTGATTAAAGAAAAAGGG + Intronic
941443736 2:165573853-165573875 AAGCTGTGTTTCAAAAACAAGGG + Intronic
941907269 2:170728972-170728994 AGGAAGTCATTCAAGAAAAAGGG + Intergenic
942589440 2:177525988-177526010 AAGCTGTCATTACAGAAAAAAGG + Intronic
942771441 2:179525709-179525731 AGGCTGATATTCAAGAAGGAAGG - Intronic
943026865 2:182640153-182640175 AAGCTGTTATTCAAGTGTGAAGG + Intergenic
943069346 2:183122455-183122477 AACCCGTTATTAAATAAAAATGG + Intronic
943174361 2:184450879-184450901 AAGGTGTAATACAAGAAATAAGG - Intergenic
943174592 2:184454452-184454474 AAGCTGTAATTAAAGTACAAAGG + Intergenic
943320998 2:186442807-186442829 AAAACGTTATTCTAGAAAAATGG + Intergenic
943380751 2:187143464-187143486 GAGTATTTATTCAAGAAAAATGG + Intergenic
946220206 2:218219119-218219141 AAGCTGATCTACAAGATAAATGG + Intronic
946890023 2:224265613-224265635 AAGCTCTTTATCAAGAGAAACGG + Intergenic
947365580 2:229391436-229391458 TAGATGTTATTCAAGAACAGTGG - Intronic
947401365 2:229734525-229734547 AGGCATTTATTCAAGAAAACTGG + Intergenic
947684193 2:232067878-232067900 ACACAGTGATTCAAGAAAAAAGG - Intronic
947695509 2:232184076-232184098 ATGCAATTACTCAAGAAAAATGG - Intronic
947891317 2:233623667-233623689 AAGATGTTGTTCAAGAAAATGGG - Intronic
1168867817 20:1104203-1104225 GAACATTTATTCAAGAAAAAAGG - Intergenic
1169057026 20:2631502-2631524 AAACTGTTCTTCAAGAATGAAGG - Intronic
1169616546 20:7453872-7453894 AAGCTAATATCCAAAAAAAAAGG + Intergenic
1169691348 20:8335862-8335884 AAGTTATTAGCCAAGAAAAAAGG + Intronic
1170088813 20:12567419-12567441 AAGCTCTTAGTGAGGAAAAAGGG + Intergenic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1170936470 20:20814373-20814395 AAGCAGTTAGGCAGGAAAAAAGG - Intergenic
1170990113 20:21293289-21293311 AAGCAGATATTTAGGAAAAATGG + Intergenic
1173388240 20:42608421-42608443 AAGCTATTATCCAAGGACAATGG - Intronic
1174947150 20:55000240-55000262 CAGATGTTATTCAAGAATTAAGG - Intergenic
1175434949 20:58938792-58938814 AAGCATGTATTTAAGAAAAATGG - Intergenic
1175526447 20:59637851-59637873 AAGCAGTCCCTCAAGAAAAATGG - Intronic
1175585279 20:60134191-60134213 AAGCAGGGAGTCAAGAAAAAAGG - Intergenic
1176276696 20:64276098-64276120 ATGATGTTAATAAAGAAAAAAGG - Exonic
1177534781 21:22410206-22410228 AACCTTTAATTCAAGAAAAAAGG - Intergenic
1177714695 21:24823898-24823920 AAGCTATTATTGAACAGAAATGG + Intergenic
1178844110 21:36160257-36160279 AGGCAGTTATTTCAGAAAAAGGG + Intronic
1178940917 21:36904873-36904895 AAAATGTTACTGAAGAAAAAAGG + Intronic
1179178988 21:39029341-39029363 CAGCTGGGATTCCAGAAAAATGG + Intergenic
1180208847 21:46281105-46281127 AAGTTGTTAATTAAAAAAAAGGG - Intronic
1182274506 22:29177820-29177842 AAACATTTATTCAAGAAAATCGG - Intergenic
1183173185 22:36202928-36202950 ACTCTGCTATTGAAGAAAAACGG + Intronic
1183570625 22:38650676-38650698 ATGCTGTGATTCTAGAATAAGGG + Intronic
1184506138 22:44904477-44904499 AAGTTGTTTTTCAAGAGCAAGGG - Intronic
1184851981 22:47126287-47126309 AAGATGTTTTTTAAGAAAGAGGG + Intronic
949153749 3:803027-803049 AAGCTTTTATTCATGACAGAAGG + Intergenic
949216916 3:1582138-1582160 TAGCAGTCATTCAAGAAAAATGG + Intergenic
949488552 3:4565062-4565084 CAGATGTTATTAAATAAAAAAGG - Intronic
949652088 3:6171421-6171443 AAGCAGTGAAGCAAGAAAAAAGG - Intergenic
950763747 3:15257842-15257864 AGGCTGTTTTTAAAGAGAAAGGG - Intronic
950840643 3:15965088-15965110 AAACGCTTTTTCAAGAAAAATGG - Intergenic
951146736 3:19235826-19235848 AAGCAATTATTTTAGAAAAATGG + Intronic
951753523 3:26063364-26063386 AAACTGCTATTTAAAAAAAAAGG - Intergenic
952066489 3:29577264-29577286 GAGCTGGTATTCAAGACACAAGG + Intronic
952547994 3:34443293-34443315 AAGCAGTTTGGCAAGAAAAAAGG - Intergenic
952641904 3:35606775-35606797 AAGCTATTATTCAAGGAAATAGG + Intergenic
952686280 3:36152172-36152194 AACCTGATACTCAAGAAAGATGG - Intergenic
953108711 3:39911392-39911414 AAACTGTTATTAAAGAAAGTGGG - Intronic
953467766 3:43139062-43139084 AAGCATTAATTTAAGAAAAACGG - Intergenic
955597040 3:60602423-60602445 AAGTTGTTATTCAGGTATAAAGG + Intronic
955919390 3:63939647-63939669 GAGCATATATTCAAGAAAAATGG + Intronic
956276126 3:67503034-67503056 AATCTGTTATTCATAAAAATAGG - Intronic
957418685 3:79939584-79939606 AAACTGGAAATCAAGAAAAAAGG + Intergenic
957567585 3:81904608-81904630 AAGTTGAAATCCAAGAAAAAGGG - Intergenic
957691444 3:83576179-83576201 AAGCTTTTATAGAAGAAAAGTGG - Intergenic
958622416 3:96578115-96578137 AAAATTTGATTCAAGAAAAATGG + Intergenic
958947826 3:100383722-100383744 AAGTTATTATTAAAGGAAAAAGG + Intronic
959229328 3:103628289-103628311 AAGCTGTTTCTCAAAAACAAAGG - Intergenic
959398791 3:105873926-105873948 AAGCCATGATTCAAAAAAAATGG + Intergenic
959459118 3:106602899-106602921 AAGCTATTCTTCAAAAAAAAAGG - Intergenic
960861430 3:122158072-122158094 AAGTATTTATTCAAGAAAACTGG - Intergenic
960896643 3:122513704-122513726 AACCGTTTATTTAAGAAAAAAGG + Intronic
961050824 3:123745418-123745440 AACTTGGTATTGAAGAAAAAAGG + Intronic
961800201 3:129441748-129441770 CGGCTGTGTTTCAAGAAAAATGG - Intronic
961910345 3:130309079-130309101 AAATTGTCATTCAAGACAAAGGG - Intergenic
962168170 3:133072630-133072652 AAGCTGTTATTTTAAAAAGAAGG - Intronic
963020858 3:140871877-140871899 AATCTGTTATGCAATAAAAATGG + Intergenic
963188679 3:142445403-142445425 AAGTTATTATACGAGAAAAAGGG - Intronic
963526407 3:146420100-146420122 GAGCATTTATTCAAGAAAAATGG - Intronic
963976197 3:151482953-151482975 AATCTGTTATTCAAAAATGAAGG + Intergenic
964001524 3:151779265-151779287 AAGATATTATTTAAGAATAAAGG + Intergenic
964050971 3:152393167-152393189 AAGCAGGTATTCATGGAAAAGGG - Intronic
964205379 3:154168775-154168797 ACGCTGTTTTTAAAGAAAAGTGG - Intronic
964385521 3:156143470-156143492 AGGTTGTTATTAAAGAAATAAGG + Intronic
964701844 3:159576275-159576297 AACCCATTATTCAATAAAAATGG - Intronic
965295779 3:166943881-166943903 AGGCTATCATTCAAGAAAATTGG + Intergenic
965329679 3:167355984-167356006 GATCTGTTTTTCAAGAAAGAAGG - Intronic
965915404 3:173840193-173840215 ATACTATCATTCAAGAAAAAGGG + Intronic
966581475 3:181570784-181570806 AAGATATTCTTAAAGAAAAAAGG + Intergenic
966708219 3:182941212-182941234 AAGCAAATATTTAAGAAAAATGG + Exonic
966737705 3:183201943-183201965 GAGCATTTATTCAAGGAAAATGG + Intronic
967043720 3:185717534-185717556 AATCTGTGAGCCAAGAAAAAAGG + Exonic
967634272 3:191782560-191782582 AAGTTGTTATTCACGAAAACAGG + Intergenic
967650417 3:191978701-191978723 AAGCATTTTGTCAAGAAAAATGG + Intergenic
967754988 3:193158600-193158622 AAGCTGTAATTCAAAGGAAATGG + Intergenic
967874699 3:194259912-194259934 AATCTGTTATTAAGGAAAAAGGG - Intergenic
968110305 3:196040797-196040819 AAGCTGTTCTTCAACAATGAAGG - Intronic
968130986 3:196192682-196192704 AAGCTGTGGTTCAGGAAAAGTGG + Intergenic
969545290 4:7822539-7822561 ATGTTTTTATTCAAAAAAAACGG + Intronic
970338916 4:15084015-15084037 AAGCTCTGTTTCAAAAAAAAAGG + Intergenic
971907605 4:32747833-32747855 ATGCTCTTTTTCAAGGAAAATGG + Intergenic
972050054 4:34719888-34719910 AAGCTGTAAAACAAAAAAAAGGG + Intergenic
972146231 4:36030153-36030175 AAGCTGTCTTTCAAGTATAATGG - Intronic
972189908 4:36577402-36577424 AATCTGTTCTTCAGGAATAAGGG + Intergenic
973305637 4:48646063-48646085 AAGCTTATTTTAAAGAAAAAAGG + Intronic
973735213 4:53864849-53864871 AGGCTGACATTCAAGAAACAAGG + Intronic
973985906 4:56352700-56352722 AAGCAGTGATGCAAGAAAAAGGG - Intronic
974332291 4:60496369-60496391 AAGTGCTCATTCAAGAAAAATGG - Intergenic
974492233 4:62581305-62581327 AAGCTAAAATTAAAGAAAAATGG - Intergenic
974663972 4:64934206-64934228 GAGCTATTATTCAAAAAAAAAGG + Intergenic
974738452 4:65972645-65972667 AAGCTGTTATTTACAAAATATGG - Intergenic
975419228 4:74142799-74142821 AAGGTATTATTCAAGGATAATGG + Intronic
976089230 4:81438457-81438479 TACCTTTTATTCAAGAAAATTGG - Intronic
976586330 4:86801091-86801113 CAACTGTTATCCTAGAAAAAGGG - Intronic
976657425 4:87503956-87503978 AAGTTTTTATTGAAGAAAACAGG + Intronic
977890469 4:102304993-102305015 AAGATGTTATTAAAGACATATGG - Exonic
978704397 4:111689427-111689449 AAGAAGTTATCCAAGTAAAAAGG + Intergenic
978748998 4:112225952-112225974 AAGATGTTCTTAAAGATAAAAGG - Intergenic
979276853 4:118823982-118824004 AAAGTTTTATTCAAGAATAAAGG + Intronic
979927005 4:126580388-126580410 AGGTTGTTAATGAAGAAAAAGGG - Intergenic
980723726 4:136730039-136730061 AAAATGTCGTTCAAGAAAAAAGG + Intergenic
981572325 4:146165825-146165847 CAGCTGTTTTCAAAGAAAAAGGG - Intergenic
981586272 4:146306007-146306029 AAGCTGTAAAACAAGAAAATAGG + Exonic
981612617 4:146611426-146611448 TAGCTGTCATTTTAGAAAAAAGG + Intergenic
981798099 4:148621871-148621893 AAACTGTTCTTCAAAAATAAAGG + Intergenic
981928297 4:150163459-150163481 TAGTAGTTATTGAAGAAAAAAGG - Intronic
982067724 4:151669243-151669265 AAGCTGGCATTCAAGACAACAGG + Intergenic
982460636 4:155665630-155665652 ACACTGTTATTCAAGAAACAAGG - Intergenic
982596328 4:157389339-157389361 AACCAGTTATTCCTGAAAAATGG - Intergenic
983023326 4:162706765-162706787 AAGCATTTATGCGAGAAAAATGG + Intergenic
984108217 4:175576782-175576804 AAGCTGTTACTGAGGAAACATGG - Intergenic
984208012 4:176809933-176809955 AAATAGTTATACAAGAAAAAAGG - Intergenic
984302191 4:177935476-177935498 AAGTGTTTATTCAAGAAAAATGG - Intronic
984356154 4:178661703-178661725 AAACTATTGTTCAAGAAAAATGG - Intergenic
984810797 4:183795151-183795173 ATGCTGTTATTTAATAATAAAGG + Intergenic
985112746 4:186563066-186563088 AAGCTGTCATTCAAAAACATGGG - Intergenic
985124289 4:186676307-186676329 AAGAGGATATGCAAGAAAAATGG + Intronic
986559079 5:9042517-9042539 ATGTTGTAATTCAAGAAAATAGG - Exonic
987194512 5:15512136-15512158 ATGCAGTTATTCAACAACAAAGG - Intronic
988428216 5:31088886-31088908 TAGCTTTTATTCAACGAAAATGG + Intergenic
988462570 5:31453656-31453678 AAGCTGTTTTACATGAGAAAAGG - Intronic
988654055 5:33188237-33188259 AAGCTGTTATTCAAACATGAAGG - Intergenic
988941641 5:36153159-36153181 AAGCTATTTTTCAACAAAATAGG + Intronic
990312137 5:54550266-54550288 AACCTGTAATTCCAGAGAAAAGG + Intergenic
990895435 5:60695303-60695325 AAGCTTTTATTCAAGGCAGAAGG + Intronic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
992297431 5:75338925-75338947 AAGCTGGTATTCCAGAAAGAAGG - Intronic
992472098 5:77068002-77068024 AAGCTGTGACTGAAGAAACATGG + Intergenic
993141616 5:84041209-84041231 AAGGTGATGTTCAAGAAAAAAGG - Intronic
993530836 5:89023347-89023369 AAGAGGTTAATGAAGAAAAAAGG - Intergenic
993772043 5:91940372-91940394 AAGGTGTTATTTAAGAAAGCTGG - Intergenic
994057479 5:95434532-95434554 CAGCTGTAATTAAAGTAAAAGGG - Intronic
994953391 5:106495826-106495848 AAGGTGGTATTCAAGCAAAATGG + Intergenic
995057923 5:107781868-107781890 AAGCATTTATTCAAAAAAAAGGG - Intergenic
995414920 5:111898992-111899014 AAGCTATTATTCAAAAATGAAGG + Intronic
995670298 5:114595362-114595384 GAGCATTTAATCAAGAAAAATGG + Intergenic
995725914 5:115180147-115180169 AAGCTGTTAACCAGGAAAAGAGG + Exonic
996176603 5:120367676-120367698 AAGCTGTTAGGGAAGAAAAATGG - Intergenic
996376441 5:122813420-122813442 AAAATGATATTCCAGAAAAAGGG - Intronic
996494184 5:124134227-124134249 AAGGTGTTATGGAAGACAAAAGG + Intergenic
996623683 5:125541920-125541942 GAGCATTTATTCAAGAAATATGG - Intergenic
996976794 5:129443877-129443899 AAGATGTTTTACAAGAATAAAGG - Intergenic
997366713 5:133330366-133330388 AAGCTTTTACTCATGAAAGAAGG + Intronic
997764820 5:136491142-136491164 AAGTGATCATTCAAGAAAAAAGG - Intergenic
997778788 5:136636411-136636433 GATCTGTTAATTAAGAAAAATGG - Intergenic
998223579 5:140307834-140307856 AAGCTGTCATTCAAAAATAAGGG - Intergenic
998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG + Intergenic
999613019 5:153391258-153391280 GAGCATTTATTCAAGAAAAATGG - Intergenic
999738144 5:154528121-154528143 AAGCTGATGTTGAAGAAAGAGGG + Intergenic
1000006742 5:157192454-157192476 AGGCTGTAATTCCAGAAAAGCGG + Intronic
1002774498 6:317333-317355 AAACTTTTGTTCAAGAGAAATGG - Intronic
1003396222 6:5754663-5754685 AAGCTGTTATTTTAGAACACTGG - Intronic
1004496917 6:16173193-16173215 AAGATGTCATTCTATAAAAAGGG + Intergenic
1005351824 6:24943603-24943625 GAGCATTTATTCAAGAAAAATGG + Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006409544 6:33864544-33864566 AAGGTATTATTAAAAAAAAAAGG - Intergenic
1007713044 6:43836750-43836772 AAGCTTGTAGTCAAGATAAAGGG + Intergenic
1008901268 6:56619591-56619613 AATCTCTTAATCATGAAAAAGGG - Intronic
1009778623 6:68239110-68239132 AAGATGTAATTAGAGAAAAATGG + Intergenic
1009967280 6:70590991-70591013 AAGCAGTGAGGCAAGAAAAAAGG + Intergenic
1010311144 6:74387492-74387514 AAGATGTTTTGCAAGAAAAATGG + Intergenic
1010516498 6:76778619-76778641 AAGTGTTTTTTCAAGAAAAATGG + Intergenic
1010666221 6:78632980-78633002 AACCTATTCTACAAGAAAAATGG + Intergenic
1010867688 6:80999955-80999977 TATCTCTTATTCCAGAAAAAGGG + Intergenic
1010923025 6:81708051-81708073 AGGCTGTTCCTCAATAAAAAGGG - Intronic
1011426201 6:87234213-87234235 AAGTTGTTGATCAAGAAACAGGG + Intronic
1011773709 6:90704839-90704861 AAGCTGGTATTAAAGAGACATGG - Intergenic
1012002628 6:93672912-93672934 AAGCTGTTTATCAAGTGAAATGG - Intergenic
1012118487 6:95334350-95334372 GTGCTGATATTCAAGAAAATGGG - Intergenic
1012150817 6:95749273-95749295 AAACCCATATTCAAGAAAAATGG - Intergenic
1012575680 6:100794798-100794820 AGGGTGTTATTCAGCAAAAATGG - Intronic
1012580631 6:100865743-100865765 ATGATGTTTTTCAAAAAAAAGGG + Intronic
1012715917 6:102669649-102669671 AAGTTTTTATTCAGTAAAAAGGG - Intergenic
1012842686 6:104349818-104349840 CAGCTGTCATTCAAGAATAGTGG + Intergenic
1014051681 6:116962451-116962473 AAGCTTTTATTCATGGAAAATGG - Intergenic
1014194127 6:118533029-118533051 AAGCAGTTATATTAGAAAAAGGG + Intronic
1014640760 6:123906655-123906677 AAGGTCTTATTAAAGAAATATGG - Intronic
1014898879 6:126938850-126938872 AAGTTGTTAATGAAGAAAAGAGG - Intergenic
1014973243 6:127845388-127845410 AAGCATTTATTGAAGAAAAATGG + Intronic
1015099036 6:129452319-129452341 AAGGTATTATTCAAAAGAAAAGG + Intronic
1016565304 6:145445580-145445602 GAGTGCTTATTCAAGAAAAATGG - Intergenic
1016676790 6:146779710-146779732 AAGCTGTCATTCAAAAATAAAGG + Intronic
1016776076 6:147906121-147906143 ACGCTTTTAATGAAGAAAAAAGG + Intergenic
1016921282 6:149296633-149296655 AAGTTATTATTAAAGAAAATGGG + Intronic
1017240340 6:152161482-152161504 ATGCTTTTTTTAAAGAAAAATGG + Intronic
1017507841 6:155084744-155084766 AAGCTGCCATTCATGACAAAGGG - Intronic
1018485323 6:164235742-164235764 AATCTGTTATGCAAGACAGAAGG - Intergenic
1018527266 6:164726990-164727012 AAGCTTTTCTTTAAGAAAACTGG - Intergenic
1020410209 7:7883825-7883847 AAGCTTTTGTTCAAGAACAAGGG + Intronic
1021041298 7:15865395-15865417 AAGCAGTAACTCAAAAAAAACGG + Intergenic
1021287763 7:18803524-18803546 AAGCTGTCTTTCAAGAATGAGGG - Intronic
1021471334 7:21005262-21005284 AAGCTGTCCTTCAAAAATAAAGG + Intergenic
1021516732 7:21497414-21497436 AAGTGTTTATTCAAGAAAAATGG - Intronic
1021677876 7:23098988-23099010 AAGTAGTTATTTAAGACAAATGG - Intergenic
1021800965 7:24306068-24306090 AATATGTTATTCAAGTAAATGGG - Intergenic
1022584146 7:31588975-31588997 TAACTCATATTCAAGAAAAATGG + Intronic
1022605735 7:31812037-31812059 GAGCTGTTACTCAATAAACAAGG + Intronic
1023060072 7:36318233-36318255 AAGCTGTTATCTAAGCAAAGGGG + Intergenic
1023133311 7:37025582-37025604 AAGCAGTGAGGCAAGAAAAAGGG - Intronic
1025062896 7:55826490-55826512 AAGCTGTCCTTTAAGAATAAAGG + Intronic
1026075632 7:67164778-67164800 AAGATGTTATTTCAGAACAATGG - Intronic
1026250081 7:68662293-68662315 AAGCATTTATTGCAGAAAAATGG + Intergenic
1026596283 7:71736589-71736611 AAGATGTTATTCAAGATGATAGG - Intergenic
1026669674 7:72378371-72378393 AAGCACTTATTCAAGAAAAATGG - Intronic
1026701225 7:72647518-72647540 AAGATGTTATTTCAGAACAATGG + Intronic
1028311397 7:89342405-89342427 TAGATGTAATTCAAGAACAAGGG - Intergenic
1029890621 7:103925926-103925948 AAGCTTTTATACAATAAAAAAGG + Intronic
1029959318 7:104672687-104672709 AAGTTGTGATTCAAAAATAAAGG - Intronic
1031274148 7:119696638-119696660 AACCTCTTATTTAAGAAAAACGG - Intergenic
1031779639 7:125945187-125945209 AATTTGTTATTCAGCAAAAATGG - Intergenic
1031824049 7:126540930-126540952 AAGCTGTTATTTAAAAAATGTGG + Intronic
1031870034 7:127081326-127081348 AAGGTGTTAGTCAGGTAAAAGGG - Intronic
1032546197 7:132745190-132745212 AAACTATAGTTCAAGAAAAAAGG + Intergenic
1033719473 7:144042721-144042743 AAGCTATTTGTCAAGAAAGAGGG + Intergenic
1033784259 7:144711961-144711983 AATCAGTGATTCCAGAAAAATGG + Intronic
1033798823 7:144877751-144877773 AAATTGCTTTTCAAGAAAAAGGG + Intergenic
1034190552 7:149210325-149210347 AAGCCAACATTCAAGAAAAAGGG - Intronic
1034594439 7:152176297-152176319 AGGCTGTTCTTCTAGAAGAAGGG + Exonic
1035186021 7:157126240-157126262 AAGGTGGTATTCAAGACACAGGG - Intergenic
1035489759 7:159264031-159264053 AAGATGTAGTTCAAGAATAATGG + Intergenic
1037661468 8:20930839-20930861 AAGTTGTTATTTAAGATAAATGG - Intergenic
1038365673 8:26931062-26931084 AAGCTCTATTCCAAGAAAAAAGG + Intergenic
1038669924 8:29574604-29574626 AGGCTGTCATTCAATACAAAGGG + Intergenic
1038738565 8:30195718-30195740 AAACTATTCTTCAAGAATAAAGG + Intergenic
1038866716 8:31446284-31446306 AAGCTGTCATTGAATAAAATGGG - Intergenic
1039257198 8:35732679-35732701 AAGCTGTGATTCAGGGAAAGTGG - Intronic
1039531050 8:38263127-38263149 AACCTGATATTCAAATAAAATGG - Exonic
1040383109 8:46892164-46892186 CAACTGTTATTCATGAAAACAGG - Intergenic
1040503133 8:48022735-48022757 AAGCTGTTCTTCAGAAACAAAGG - Intronic
1040760156 8:50831899-50831921 AAAGTGTTTATCAAGAAAAATGG - Intergenic
1040808943 8:51428741-51428763 AAACTATTATTCAAAAAAATAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041359112 8:57031751-57031773 GAGCTGCTATTAAAGAACAATGG + Intergenic
1041471736 8:58217409-58217431 ATGCTGTCATCCAAGAAATACGG - Intergenic
1041522191 8:58769097-58769119 AAGCTCTTATTCATGGCAAAAGG + Intergenic
1041612578 8:59869429-59869451 AAGCTGGTTCTCAAAAAAAATGG + Intergenic
1041734971 8:61100536-61100558 AAGCTGTTTTTGAAAAAAGAAGG - Intronic
1041990386 8:63982305-63982327 AAGCTTTTATTCAAGCATTAGGG - Intergenic
1042046404 8:64657256-64657278 AAACTGTTTTTCTAGAAAGAGGG + Intronic
1043352893 8:79382209-79382231 AAGCTCCTTTTCAAGAGAAAGGG - Intergenic
1043664870 8:82796945-82796967 AAACTGTTATTAGAAAAAAATGG + Intergenic
1043776050 8:84270426-84270448 AAGTAATTATTCAGGAAAAAGGG + Intronic
1043920509 8:85978012-85978034 AAGCTATTAATCAAGAGCAATGG + Intergenic
1044044646 8:87416376-87416398 GAGCATTTATTCAAGAAAAGTGG + Intronic
1044269877 8:90229551-90229573 AAGCTGGCAGTCAAGAAGAATGG + Intergenic
1045117164 8:98995257-98995279 AAATTGTTATTTAAGAGAAAAGG - Intergenic
1046087608 8:109458016-109458038 AAGCTGTTTATCAAGACAATGGG - Intronic
1046294891 8:112204641-112204663 CAGCTGTTTCTCAAGGAAAAAGG + Intergenic
1046312459 8:112455855-112455877 AAGCTGGGATTTAAAAAAAAAGG + Intronic
1046493924 8:114988528-114988550 AAACTGTGAGTCAATAAAAAAGG + Intergenic
1046699116 8:117380029-117380051 AAGCTGTTACTTCAGAAAATTGG + Intergenic
1048077400 8:131086869-131086891 AAGCTGTCATTCAAGACTGAGGG - Intergenic
1048782640 8:138018340-138018362 AAGCTGTTAAATAAGAAATAAGG + Intergenic
1050485729 9:6132854-6132876 CAGCCGTGATTCAAGAAATAGGG - Intergenic
1050961134 9:11733637-11733659 AAGCATTTATTCAAGTGAAATGG + Intergenic
1051071569 9:13174427-13174449 TATCAATTATTCAAGAAAAATGG + Intronic
1051379945 9:16446730-16446752 AGACTGTTACTGAAGAAAAAAGG - Intronic
1052735394 9:32336957-32336979 AAGCATTTATTCAAGAAAAGTGG + Intergenic
1052958913 9:34277713-34277735 AAGCTGTTATTGGAAAAAATTGG - Intronic
1054894412 9:70292034-70292056 AAGCTGTTATTCAAGAAAAATGG - Intronic
1055188943 9:73493817-73493839 ATGGTGTTATTCAAGATATATGG + Intergenic
1055731820 9:79286474-79286496 AAGCTGTCAGTCAAGAAAGGAGG - Intergenic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1056267758 9:84916351-84916373 AAAATGTTAGTCAACAAAAAGGG + Intronic
1056502989 9:87228932-87228954 ACATTGTTTTTCAAGAAAAATGG - Intergenic
1056506029 9:87259147-87259169 AAGCTGTGACTCAAGACAAGTGG + Intergenic
1056703843 9:88934767-88934789 TAGCTGTTATTAAAGAACTATGG + Intergenic
1056854286 9:90111920-90111942 AAGATGTTACTCATGAAACAAGG - Intergenic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1057304933 9:93906576-93906598 ATGGTGTTATTTAAGAAAAGGGG + Intergenic
1057356411 9:94335513-94335535 AAGCTGTTGTTTGAGATAAAAGG + Intergenic
1057373951 9:94501210-94501232 AAGCATTTATTCATGAAAAATGG - Intergenic
1057651338 9:96922114-96922136 AAGCTGTTGTTTGAGATAAAAGG - Intronic
1058032901 9:100218757-100218779 AAGCTGTTTATCTAGAGAAATGG + Intronic
1058149057 9:101443830-101443852 AAGCTGTCAGTTAAAAAAAATGG + Intergenic
1058303987 9:103413506-103413528 AAACTGTCATTCTAGAAATAAGG - Intergenic
1058553393 9:106139686-106139708 AAAGTTTTATTAAAGAAAAATGG - Intergenic
1059143906 9:111880055-111880077 AAGCTTTTATTCAAGAAAAATGG + Intergenic
1059577662 9:115507928-115507950 GAGCTTTAATTCAAGAAAAATGG - Intergenic
1059692845 9:116702348-116702370 AACCTGTTAAGCAAGAAGAAAGG - Intronic
1061679078 9:132233881-132233903 AAGCTGTTTCAGAAGAAAAAAGG + Intronic
1061977510 9:134077436-134077458 AATCTATTTCTCAAGAAAAAAGG + Intergenic
1062275824 9:135730142-135730164 AATCTGTCATTAAAGAGAAAGGG - Intronic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1185862626 X:3593207-3593229 AATCTGTTATTCAATATAATTGG + Intergenic
1187564649 X:20436500-20436522 TAGATCTTATTTAAGAAAAAAGG - Intergenic
1187664303 X:21587251-21587273 AAACTATTATTCAAGAGGAAAGG + Intronic
1187914605 X:24141773-24141795 AAAATGTTATTCAGGAAACAAGG + Intergenic
1187952134 X:24481330-24481352 AAGGTGGAAGTCAAGAAAAAGGG - Intronic
1188210171 X:27414324-27414346 AAGCAATACTTCAAGAAAAATGG + Intergenic
1188328073 X:28831660-28831682 CAGCATTTATTCAAGAAAAATGG - Intronic
1189077573 X:37933270-37933292 GAGCATTTATTCAAGAACAATGG + Intronic
1189824606 X:44904865-44904887 AAGCGTTTAGTGAAGAAAAATGG - Intronic
1192691943 X:73373655-73373677 AAGCTGTAATACAGCAAAAATGG + Intergenic
1192724911 X:73739392-73739414 AAGATGTTCTTCAATAAAACAGG + Intergenic
1193043911 X:77032400-77032422 AAGCTGTTATTCCAAAATAAAGG + Intergenic
1193266310 X:79474237-79474259 AAGCCATTAATCGAGAAAAAAGG + Intergenic
1193329381 X:80218532-80218554 GAGCTTTTACTCATGAAAAAAGG - Intergenic
1193573053 X:83167994-83168016 AAACAGTTATTTAAGAATAAAGG - Intergenic
1193680955 X:84518547-84518569 AAGCTGGTAGTGAAGACAAAGGG - Intergenic
1193682035 X:84533494-84533516 AAGCTGTTAATTATAAAAAAGGG - Intergenic
1194295152 X:92118123-92118145 AATCTGTGGCTCAAGAAAAAAGG - Intronic
1194485986 X:94487037-94487059 AACTTGTTATTTAAGAAAGAAGG + Intergenic
1194496044 X:94617719-94617741 AGACTGTTATAAAAGAAAAAGGG - Intergenic
1194689381 X:96963826-96963848 AGGATTTTATTCAAGAAAAATGG - Intronic
1194917218 X:99721303-99721325 AAGCTGTTCTTCAGTAATAAAGG + Intergenic
1195937599 X:110140416-110140438 AAGTTTTTCTTAAAGAAAAAAGG + Intronic
1196091774 X:111751714-111751736 AAGCTGATTTTAAAAAAAAATGG + Intronic
1196130965 X:112155690-112155712 AAGCATTTATTCAAGAAAAGTGG - Intergenic
1196204017 X:112918592-112918614 AAGCTATTCATCTAGAAAAAGGG - Intergenic
1196699732 X:118655101-118655123 AAGCTGTTATAAAAGAAGACTGG + Intronic
1197348477 X:125352719-125352741 AAGCTTTTGTTAAAAAAAAAAGG + Intergenic
1197526909 X:127575516-127575538 AAGCTGTAATTCAAGAAATTTGG + Intergenic
1197565498 X:128079563-128079585 AAGCTCTTTTTTAAAAAAAATGG + Intergenic
1197787922 X:130218536-130218558 AAGCTGTTCTTCAAGTACATGGG - Intronic
1197861258 X:130973208-130973230 GTGCATTTATTCAAGAAAAATGG - Intergenic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1198170473 X:134100415-134100437 GAGCACTTAATCAAGAAAAATGG - Intergenic
1198389942 X:136163581-136163603 AAGCTCTTTTGCAGGAAAAATGG + Intronic
1198488640 X:137115060-137115082 GAGTATTTATTCAAGAAAAATGG - Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200612652 Y:5342647-5342669 AATCTGTGGCTCAAGAAAAAAGG - Intronic
1200634184 Y:5629466-5629488 AAGTTGCTATTCAAGAAGAGGGG - Intronic
1201364999 Y:13195122-13195144 AAACTGTTCTTCAAAAATAAGGG - Intergenic