ID: 1054895991

View in Genome Browser
Species Human (GRCh38)
Location 9:70311968-70311990
Sequence CCACCATGCTAGGCTAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 539}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054895991_1054895996 8 Left 1054895991 9:70311968-70311990 CCTGTATTAGCCTAGCATGGTGG 0: 1
1: 0
2: 1
3: 50
4: 539
Right 1054895996 9:70311999-70312021 TGTAATCCCAGCTATGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054895991 Original CRISPR CCACCATGCTAGGCTAATAC AGG (reversed) Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
901377477 1:8849491-8849513 ACACCAGGCTAGGCTAGGACTGG - Intergenic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
902289747 1:15428342-15428364 CCACCATGCCCGGCTAATTTTGG - Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
903482665 1:23665604-23665626 CCACCATGGCAGGCTAATTTTGG + Intergenic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
903910654 1:26722396-26722418 CCACCATGCCAGGCTAATTTTGG + Intronic
904057029 1:27677836-27677858 CCACCATGCTTGGCTAATTATGG - Intergenic
904057203 1:27679223-27679245 CCACCATGCTCAGCTAATTATGG + Intergenic
904173736 1:28610600-28610622 CCACCATGCCAGGCCACTAGTGG + Intronic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
905615678 1:39396165-39396187 CCACCATGCCCGGCTAAGATGGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
909159761 1:72131807-72131829 CCACCACGCTCAGCCAATACTGG - Intronic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
912318432 1:108687695-108687717 CCACCATGCCAGGCCACCACTGG + Intergenic
912505976 1:110156410-110156432 CCACCATGCTAGGCCATCCCAGG - Intronic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
913015172 1:114725786-114725808 CCACCATGTCAGGCTAATTTTGG + Intronic
914320108 1:146551101-146551123 CCACCATGCCAGGCCAAGATGGG - Intergenic
915364504 1:155307065-155307087 CCACCATGCTGGGCTAATTTTGG + Intergenic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
916139990 1:161687975-161687997 CCACCATACCAGGCTAATTTTGG - Intergenic
916957262 1:169851704-169851726 CAACCATACTAGGCAAATTCTGG - Intronic
917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG + Intronic
918769530 1:188536850-188536872 CCACCATGCCCGGCTAATTTTGG - Intergenic
918896273 1:190350973-190350995 CCATCATGCCAGGCTAATTTTGG + Intronic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
920214483 1:204352219-204352241 CCACCATGCCGGGCTAATTTTGG - Intronic
920289949 1:204914328-204914350 CCTCCATGCTATGCTCATAATGG + Intronic
920512696 1:206562643-206562665 CCACCACGCCCGGCCAATACTGG - Intronic
920678566 1:208055640-208055662 CCACCGTGCCAGGATAATGCTGG - Intronic
921277278 1:213532623-213532645 CCACCAGGCCAGGCTAATCAAGG + Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
1063030529 10:2229838-2229860 CCACCATACCTGGCTAATTCAGG + Intergenic
1064357216 10:14630696-14630718 CCATCATGCTTGGCTAATTTTGG - Intronic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065655036 10:27939583-27939605 CCACCATGCCTGGCTAATGTAGG - Intronic
1066092204 10:32034262-32034284 GCACCATGCCAGGCTAATTTTGG + Intronic
1066371249 10:34819993-34820015 CCACCATGCTCAGCTAGAACTGG - Intergenic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1069455008 10:68547092-68547114 CCACAATGCCAGGCTAAAATGGG - Intergenic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1069910971 10:71759020-71759042 CCACCATGCCAGGCAAATTTTGG + Intronic
1069937353 10:71926957-71926979 CCACCATGCCCGGCTAATTTGGG + Intergenic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070105550 10:73427549-73427571 TCATCATGCCCGGCTAATACAGG + Intronic
1070615821 10:77968535-77968557 CCACCATGCCCGGCTAATTTTGG - Intergenic
1070905811 10:80072196-80072218 CCACCATGCCCGGCTAATTTTGG + Intergenic
1070906287 10:80076325-80076347 CCACCACGCTTGGCTAATTGTGG - Intergenic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071113772 10:82193293-82193315 CCACCATGCCCGGCTAATTTGGG + Intronic
1071154759 10:82675594-82675616 CCACCAGGCTAGGCAGATAGAGG - Intronic
1072698629 10:97623290-97623312 CCACCATGCTTGGTTGATAGAGG - Intronic
1073109592 10:101053424-101053446 CCACCATGCTAAGCTATTTGGGG + Intergenic
1073415868 10:103381417-103381439 CCACCCTGCTTGGCTAATTTTGG + Intronic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1074270952 10:111952898-111952920 CTACCATGATATTCTAATACAGG - Intergenic
1075046664 10:119151666-119151688 CCACCATGCCCGGCTAATTTTGG + Intronic
1075374073 10:121963941-121963963 CCACCATGCCCGGCTAATTTTGG - Intronic
1075473092 10:122708279-122708301 TCTTCATGCCAGGCTAATACAGG - Intergenic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1076711930 10:132341141-132341163 CCACCATGCCTGGCTAATGTTGG - Intronic
1078899942 11:15632462-15632484 CCACCATGCCAGGTTAATTTTGG + Intergenic
1079504820 11:21141914-21141936 CCACCATGCTCAGCTAATTTTGG + Intronic
1079948359 11:26770597-26770619 CCACCATGCCCAGCTGATACTGG + Intergenic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080276916 11:30513155-30513177 CCTCCTTGCTAGGGTAATGCTGG - Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080680597 11:34472366-34472388 CAACCATGATAGGCAAATATGGG - Intergenic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081553051 11:44131888-44131910 CCACCATGCCCGGCTAATTTTGG + Intronic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1085114780 11:73921145-73921167 CCACCATGCCTAGCTAATATTGG - Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085252969 11:75155608-75155630 CCACCATGCCCGGCTAATTTTGG + Intronic
1085482170 11:76831668-76831690 CCACCATGCCCAGCTGATACTGG - Intergenic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1086366638 11:86113703-86113725 CCAGCTTGCTTGGCTATTACAGG - Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1087985778 11:104677570-104677592 CCACCATGCCTGGCTAATGTTGG - Intergenic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1091552683 12:1548737-1548759 CCACCATGCCCGGCTGAGACTGG - Intronic
1091719577 12:2803013-2803035 CCACCAGGCTTGGCCTATACAGG + Intronic
1091736726 12:2928653-2928675 CCAACATGCCAGGCCAACACTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1092182274 12:6453860-6453882 CCACCATGCCCGGCTAATTTTGG - Intronic
1092295408 12:7193384-7193406 CCACCATGCCCGGCTAATTTTGG + Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1094459996 12:30685770-30685792 CCACCATGCTTGGCTAATTTTGG - Intronic
1095723608 12:45427785-45427807 CCACCATGCCCGGCTAATTTTGG - Intronic
1097690178 12:62727811-62727833 CCACCATGCCCGGCTAATTTTGG + Intronic
1098841076 12:75479081-75479103 CCACCATGCCAGGCTAATTTTGG + Intergenic
1098960157 12:76731629-76731651 CCACCATGCCCGGCTAATTTTGG + Intergenic
1098968105 12:76816271-76816293 CCACCATGGTGGACTAATCCAGG + Intronic
1099007421 12:77250517-77250539 CCACCACGCCAGGCTAATTTTGG - Intergenic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099216490 12:79860054-79860076 ATATAATGCTAGGCTAATACAGG + Intronic
1099977024 12:89556773-89556795 CCACCAGGCCTGGCTAATTCTGG + Intergenic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1101387205 12:104268370-104268392 CCACCATGCCCGGCTAATATGGG - Intronic
1101485181 12:105150629-105150651 CCACCATGCCCGGCTAATTTTGG - Intronic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102361298 12:112290166-112290188 CCACCTTGCTGGGCTAATTTTGG - Intronic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1102660332 12:114521530-114521552 CCACCATGCCCGGCTAATTTTGG - Intergenic
1104244153 12:127021356-127021378 CCAGCATGCTTGGCTAATTTTGG - Intergenic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1104867503 12:131966749-131966771 CCACCATGCCCGGCTAATTGTGG - Intronic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1105740385 13:23317040-23317062 CCACCATGCCCGGCTAATCTTGG - Intronic
1106247025 13:27959259-27959281 CCACCATGCCCGGCTAATTTTGG - Intergenic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1107604414 13:42043490-42043512 CCACCATGCTGGGCTCATTTTGG + Intronic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1110432764 13:75444284-75444306 CCACCATGCTCGGCTCATTGAGG + Intronic
1111014156 13:82355434-82355456 CCACCATGCCAGGCTAATTTTGG + Intergenic
1111228359 13:85306721-85306743 CCACAATGCCAGGCTAATTTTGG + Intergenic
1111732568 13:92095685-92095707 CCACCATGCCCGGCTAATTTTGG + Intronic
1111891504 13:94088426-94088448 CCAAAATGCTAGGATATTACGGG - Intronic
1112005605 13:95251073-95251095 CCACCAAGCTTGGCCAATAGTGG + Intronic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1113210558 13:107974500-107974522 CCACTATGCTAGCTTAATATGGG - Intergenic
1113826148 13:113255498-113255520 CCACCATTATAGGATCATACAGG + Intronic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1115645878 14:35368146-35368168 CCCCCATGCCAGGCTGCTACAGG - Intergenic
1116998736 14:51351133-51351155 CCACCATGCCCGGCTAATTTTGG - Intergenic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117651663 14:57914274-57914296 CCACCATGCCCGGCTGAGACTGG - Intronic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1118216474 14:63813505-63813527 CCACCATGCCCAGCCAATACAGG - Intergenic
1118618333 14:67591682-67591704 CCACCATGCTCAGCTAATTTTGG + Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1119496819 14:75086751-75086773 CCACCATGCCCGGCTAATTTTGG - Intronic
1119634194 14:76260875-76260897 CCACCAGGCCAGGCTAATTTTGG - Intergenic
1120215005 14:81672282-81672304 CCACCATGCTCGGCTTATAATGG - Intergenic
1120955373 14:90077406-90077428 CCACCATGCCCGGCCAATCCTGG + Intronic
1121008586 14:90506314-90506336 CCACCATGCCCGGCTAATTTTGG - Intergenic
1121068979 14:90999053-90999075 CCACCATGCCCAGCTAATTCGGG - Intronic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1121569072 14:94933010-94933032 CCACCATGCCCGGCTAATTTTGG + Intergenic
1202939245 14_KI270725v1_random:129400-129422 CCACCATGCCAGGCTAATTTTGG - Intergenic
1123818776 15:24005535-24005557 CCACCATGCCCGGCTAATTTTGG + Intergenic
1124032359 15:26023092-26023114 CCACCATGCCCGGCTAATTTGGG + Intergenic
1125133271 15:36309921-36309943 CCACCATGCCTGGCTAATCTTGG + Intergenic
1125628703 15:41130245-41130267 CCACCACGCTGGGCTAATTTTGG - Intergenic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1126017504 15:44366479-44366501 CCACCATGCATGGCTAATTGTGG - Intronic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1126636591 15:50786116-50786138 CCACCATGCTTGGCTAATTTTGG + Intergenic
1127085852 15:55423935-55423957 CCACCATGCCCGGCTAATTTTGG - Intronic
1128016228 15:64349785-64349807 CCACCATGCTAGGTTCATTTTGG - Intronic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1128828869 15:70748077-70748099 ACACCAAGCTAGGCTGACACTGG + Intronic
1129087688 15:73113379-73113401 CCACCATGCTAGGTGGGTACTGG + Intronic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1133197647 16:4182889-4182911 CCACCATGCCCGGCTAATTTAGG - Intergenic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133480036 16:6161234-6161256 CCACCATGCCAAGCTAATTTTGG - Intronic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133800725 16:9082904-9082926 CCACCATGCCGGGCTAATTTTGG + Intergenic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1134191829 16:12127572-12127594 CCACCATGCCCGGCTAATTTTGG + Intronic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134536425 16:15030255-15030277 CCACCATGCCCGGCCAATTCAGG - Intronic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136521093 16:30796326-30796348 CCACCATGCTGGGCTAATTTTGG + Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1139398800 16:66663351-66663373 CCACCATGCCTGGCTAATCTTGG - Intronic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1139833232 16:69817809-69817831 TCACCATGCTTGGCTAATTTTGG + Intronic
1139859644 16:70010531-70010553 CCACCATGCCCGGCCAATTCAGG + Intergenic
1140013417 16:71158976-71158998 CCACCATGCCAGGCCAAGATGGG + Intronic
1140345383 16:74208314-74208336 CCACCACGCCAGGCTATGACAGG - Intergenic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1140818214 16:78639851-78639873 CCACCATGCTAGGCCCAGATTGG + Intronic
1141429244 16:83962526-83962548 CCACCACGCCAGGCTAATTTAGG + Intronic
1141739453 16:85881214-85881236 CCACCATGCTGGGCTAATTTTGG - Intergenic
1143222750 17:5276274-5276296 CCACCATGCCCGGCTAATTAAGG - Intergenic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143466156 17:7138080-7138102 CCACCATGCCCGGCTAATTTTGG + Intergenic
1143812774 17:9485871-9485893 CCACCATGCTCGGACAATCCGGG + Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1146181749 17:30702883-30702905 CCACCATGCTAGCCTAGCCCTGG + Intergenic
1146211288 17:30945601-30945623 CCACCATGCTTAGCTAATTTTGG - Intronic
1146391453 17:32427253-32427275 CCACCATGCCCGGCTAATTTTGG + Intergenic
1146698849 17:34935702-34935724 CCACCATGCCAGGGTAATTTTGG - Intronic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147378856 17:40040229-40040251 CCACCATGCCCGGCTAATTTTGG + Intronic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147844205 17:43393498-43393520 CCACCATGCCCGGCTAATTTTGG - Intergenic
1147859472 17:43509634-43509656 CCACCATTCTTGGCTAATTTTGG + Intronic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1148003270 17:44403358-44403380 CCACCATGCTCGGCCCATGCTGG + Intronic
1148637579 17:49160461-49160483 CCACCATGACAGGCGAGTACAGG - Intronic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1150839607 17:68595629-68595651 CAACAATGCTAAGCTAAGACAGG - Intronic
1151334756 17:73433437-73433459 CCACCATGCCCGGCTAATTTTGG + Intronic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1151610860 17:75173786-75173808 CCACCCTGCTAGGACAAAACTGG + Intergenic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152962804 18:89730-89752 CCACCATGCCCGGCTAATGGAGG - Intergenic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153272531 18:3336731-3336753 CCACCATGTAAGGCTAATTTTGG + Intergenic
1153452347 18:5243779-5243801 CCACCATGCCCGGCTAATTTTGG - Intergenic
1153965646 18:10179148-10179170 CAACCATCCTAGGTTAAAACAGG - Intergenic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1154530715 18:15341976-15341998 CCACCATGCCCGGCTAATTTTGG + Intergenic
1155021959 18:21904757-21904779 CCACCATGTTATGCTGACACTGG - Intergenic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1156620174 18:38842322-38842344 ACATCATGCTAGGCTATTGCAGG - Intergenic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157748943 18:50161229-50161251 CCACCATGCCCGGCTAATTTTGG - Intronic
1157829350 18:50842206-50842228 CCACCATGCCAAGCTAATTTTGG + Intergenic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1158715962 18:59880099-59880121 CCACCACGCTGGGCTAATTTTGG + Intergenic
1158937348 18:62376673-62376695 CCACCATGATAGTCTCCTACAGG + Intronic
1160629359 18:80234618-80234640 CCACCATGCCCCACTAATACTGG - Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1160829991 19:1099425-1099447 CCACCATGCTCGGCTAATTTTGG - Intergenic
1160893166 19:1390185-1390207 CCACCACGCCCGGCTAATGCAGG + Intronic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161508794 19:4658953-4658975 CCACCATCCTTGGCTAATTTTGG + Intronic
1161621628 19:5300616-5300638 CCACCATGCCCGGCTAATTTTGG - Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161788879 19:6346639-6346661 CCAAAATGCTAGGATAATCCTGG + Intergenic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162977084 19:14212922-14212944 CCACCATGCTAGCCTAGCCCTGG - Intergenic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1163043967 19:14625265-14625287 CCACCATGCCCAGCTAATGCTGG + Intronic
1163071513 19:14845998-14846020 CCACCATGCCAGGCTAATTTTGG - Intergenic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163345139 19:16736380-16736402 CCACCATGCTTGGCTTTGACTGG + Intronic
1164532890 19:29061525-29061547 CCACCATGCCCGGCCAATAGAGG - Intergenic
1164561174 19:29293250-29293272 CCTCCCTGCTAGGCTAAAAGTGG - Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1165192281 19:34074997-34075019 CCACCATGCCCGGCTAATTTTGG + Intergenic
1166392267 19:42415521-42415543 CCACCATGCCCAGCTAAGACTGG - Intronic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166729179 19:45048831-45048853 CCACCACGCTTGGCTAATTTTGG - Intronic
1167003662 19:46761121-46761143 TCACCATACTTGGCCAATACTGG - Intronic
1168528196 19:57105619-57105641 CCACCATGCCAGGCTAATGTTGG + Intergenic
1168612372 19:57811563-57811585 CCACCATGCCCGGCTAATGAAGG - Intronic
926105720 2:10149279-10149301 CCACCATGCCCGGCTAATTTTGG + Intronic
926272973 2:11380996-11381018 CCACCATGCTGGGCTAAGGTGGG + Intergenic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928421815 2:31142968-31142990 CCACCATGCCCGGCTAATTTTGG - Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930204815 2:48577426-48577448 CCACCACGCCAGGCTAATTTTGG - Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
931995029 2:67831564-67831586 CCACCATGCCAGGCTAATTTTGG + Intergenic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932790452 2:74650260-74650282 CCACCATGCCCGGCTAATTTTGG - Intergenic
933732115 2:85464936-85464958 CCACCATGCCCGGCTAATTTGGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
937176232 2:119938412-119938434 CCACCATGCCTGGCTAATGTGGG + Intronic
937960939 2:127458149-127458171 CCACCATGTCTGGCTAATATAGG - Intronic
938793916 2:134702490-134702512 CCACCATGCCCGGCTAATTTTGG - Intronic
938821018 2:134960320-134960342 CCACCATGCCCGGCTAATTTTGG + Intergenic
938897524 2:135767071-135767093 CCACCATGCCAGACTAGCACTGG - Intronic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939433767 2:142146458-142146480 CCACCGTGCCCGGCTAATTCTGG - Intergenic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940580684 2:155575621-155575643 CCGCCACACTAGGCTAATCCAGG + Intergenic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
942350364 2:175046262-175046284 TCACCATGCTCGGCTAATGTTGG + Intergenic
943690525 2:190865058-190865080 CCACCATGCCCAGCTAATTCAGG - Intergenic
944065935 2:195618938-195618960 CCATCATGCCAGGCTAATTTTGG - Intronic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
944316491 2:198290757-198290779 CCACCATGCTCGGCTAAATTTGG - Intronic
945071207 2:205990809-205990831 CCACCATGCCCAGCCAATACAGG + Intergenic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
946435332 2:219648082-219648104 CCACCATGTCAGGCTCACACTGG + Intergenic
946749461 2:222879163-222879185 CCACCATGCCCGGCTAATTTTGG - Intronic
946848160 2:223879504-223879526 CCACCAGGCTTGGCTAATTTTGG - Intronic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947770818 2:232668784-232668806 CCACCATGCCCGGCTAATTTTGG + Intronic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169995656 20:11553320-11553342 CCACCATGGTAGGCCGATAATGG - Intergenic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1172597750 20:36161911-36161933 CCACCATGCCCGGCTAATTTGGG + Intronic
1172718177 20:36979373-36979395 CCACCATGCCCGGCCGATACAGG + Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174324271 20:49766798-49766820 CCACCACACCTGGCTAATACTGG + Intergenic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1178241943 21:30912846-30912868 CCACCAGTCTTGGCTAATTCAGG - Intergenic
1178336699 21:31749818-31749840 CCACCACGCCTGGCTAATTCTGG - Intergenic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1181154854 22:20913332-20913354 CCACCATGCTCAGCTAATTTTGG + Intergenic
1181302683 22:21892682-21892704 CCACCATGCCCGGCCAATATTGG - Intergenic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1183249352 22:36718557-36718579 CCACCATGCCCGGCTAAGATGGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184365335 22:44047506-44047528 CCACCATGCCCGGCTAATTTTGG - Intronic
949348833 3:3103025-3103047 CCACCATGCTGGGCTAATGTGGG + Intronic
951173300 3:19568506-19568528 CCACCACGCCCGGCTAGTACTGG - Intergenic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
952144144 3:30513418-30513440 CCTTCATGCTAGGTTAACACAGG + Intergenic
952862255 3:37822742-37822764 CCACCATGCTAGGGTTCAACAGG - Exonic
953240820 3:41147957-41147979 CCACCATGCTAGGCCCACTCGGG - Intergenic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
954103496 3:48396316-48396338 CCACCATGCCCGGCTAATTTTGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
955012824 3:55036292-55036314 CCATCATGCCCGGCTAATTCTGG - Intronic
955180249 3:56661297-56661319 CCACCACGCTAGGGTAATTTTGG + Intronic
956200342 3:66699021-66699043 CCACCATGCCCAGCTAATCCTGG - Intergenic
957546898 3:81650815-81650837 CCACCATGCTCAGCTAATTTTGG + Intronic
957868660 3:86058939-86058961 TCACCATGCCAGGCTAATTTTGG - Intronic
958045404 3:88278650-88278672 CCACCATGCAAGGCTGATTTGGG + Intergenic
958550860 3:95609954-95609976 CCACCAGGCTAGGAGGATACAGG + Intergenic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
961016307 3:123470896-123470918 CCACCATGCCTGGCTAATCTTGG + Intergenic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
961786578 3:129350820-129350842 CCACCATGCCCGGCTAATTTTGG - Intergenic
962362443 3:134753599-134753621 CTACCATGATAGGCTAAGTCAGG - Intronic
962446893 3:135473903-135473925 CCACCGTGCAAGTCAAATACAGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
965311970 3:167139495-167139517 CCAACATGCCAGGCCAATTCTGG + Intergenic
966173582 3:177111423-177111445 CCACCATGCCAGGCTAATTTGGG + Intronic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
966841347 3:184090725-184090747 CCACCATGCCAGGCCAATTGTGG + Intergenic
967356695 3:188579815-188579837 CCATCATGCCTGGCTAATCCTGG - Intronic
968126216 3:196162447-196162469 CCAACATGCCTGGCTAATTCTGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968580487 4:1389623-1389645 GCACTTTGCTAGGCTAAGACAGG - Intergenic
968630262 4:1647045-1647067 CCACCATGCCCGGCTTTTACTGG - Intronic
969035776 4:4252463-4252485 CCACCATGCCCGGCTAATTTCGG + Intergenic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
969572260 4:8016194-8016216 CCACCATGCCAGGTTAATTTTGG + Intronic
969823893 4:9741401-9741423 CCACCAGGCTACGCTATCACAGG + Intergenic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
973318510 4:48786006-48786028 CCACCATGCCCGGCTAATTTTGG + Intergenic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
974731470 4:65872169-65872191 CCACCATGCCCGGCTAATTTTGG - Intergenic
974769266 4:66389535-66389557 CCACCATGCCAGGCTAAGATGGG + Intergenic
975408698 4:74022668-74022690 CCACCATGCTCAGCTAATTTTGG + Intergenic
975736046 4:77382293-77382315 CCATCATGTTAGGGTAATAGAGG + Intronic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
978192292 4:105928324-105928346 CCACCACGCCAGGCCAATAATGG - Intronic
978496057 4:109360246-109360268 CCACCATGCCCGGCTAATTTTGG - Intergenic
978714595 4:111826076-111826098 CCACCATGCCCGGCTAATAGAGG + Intergenic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
980910040 4:138986061-138986083 CCACAATGCTTGGCTAATCCTGG - Intergenic
981166586 4:141566169-141566191 CCACCATGCTAGGAGGATAGAGG + Intergenic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
986166294 5:5274297-5274319 CCACCATGATAGTATAATATAGG + Intronic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
989521216 5:42402970-42402992 CCACCATGCATGGCTAATTTTGG - Intergenic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
990711590 5:58587217-58587239 CCACCATTCTAAGCTTATACTGG + Intronic
991338288 5:65575308-65575330 CCAGCATCCTAGGCTATTCCTGG + Intronic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992114619 5:73527425-73527447 CCACCACGCCCGGCTAATATTGG - Intergenic
993339199 5:86701830-86701852 CCATCATGCAAGGCTATTAGAGG - Intergenic
993632178 5:90299778-90299800 CCACCATGCCAGACTAATTTTGG - Intergenic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994503684 5:100612845-100612867 CCACCAATCTAGTGTAATACTGG - Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
996525920 5:124479346-124479368 CCACAATGTTTGGCTAATATTGG - Intergenic
997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG + Intronic
997462388 5:134062137-134062159 CCACCATGCCCGGCTAATTTTGG + Intergenic
997768949 5:136534949-136534971 CCACCATGCCCGGCTAATTTTGG + Intergenic
997998014 5:138602185-138602207 CCACCATGCCAGGCTGAGAGTGG + Intergenic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
998497366 5:142602327-142602349 CCACCATGCCCGGCTAATTTTGG + Intronic
999057170 5:148590447-148590469 CCACCATGCTTGGCTAATTTTGG + Intronic
999894883 5:156021345-156021367 TCACCATGCTTGGCTAATTAAGG - Intronic
1000247461 5:159460545-159460567 CCACCATGATAGTCTCATACAGG - Intergenic
1001583234 5:172814407-172814429 CCACCATGCTCGGCTAATTTTGG - Intergenic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002668421 5:180845179-180845201 CCACCATGCCAGGCTAACTTTGG - Intergenic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1003699776 6:8448957-8448979 CCACCATGCCCGGCTAATTTTGG - Intergenic
1003918519 6:10809943-10809965 CCACCATGCCCGGCTAATTTTGG - Intronic
1004148642 6:13093489-13093511 CCAGCATGCTACTCTAACACTGG + Intronic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004401513 6:15293260-15293282 CCACCACGCCAGGCTAATAAGGG - Intronic
1004628602 6:17399932-17399954 CCACCATGCCCGGCCACTACAGG - Intronic
1005991651 6:30906869-30906891 CCACCACGCCCGGCTAATTCTGG - Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1006881046 6:37340250-37340272 CCACCATGCTGGGCTAATTTAGG - Intergenic
1006908488 6:37548729-37548751 CCACCATGCCAGGCTGTTTCAGG - Intergenic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1008221027 6:48853618-48853640 CCACCATGCTGGGCTAACGAAGG - Intergenic
1009838187 6:69031785-69031807 CCACCACGCCAGGCTAATTTTGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010040223 6:71372951-71372973 CCACCATGCCCGGCTAATTTTGG - Intergenic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010687525 6:78869954-78869976 CCACCATGCTTGGCTAATTTTGG - Intronic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011532753 6:88341971-88341993 GCACCATGCTAGCCTGTTACAGG + Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1012230529 6:96755733-96755755 CCACCATGCCCGGCTAATTTTGG - Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013490055 6:110637690-110637712 CCACCACGCTAGGCCTATTCTGG - Intronic
1014995208 6:128134656-128134678 CCACCATGCCTGGCTAATGTTGG - Intronic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1016024729 6:139274746-139274768 GCAGCATTCTAGACTAATACAGG - Intronic
1016158589 6:140846151-140846173 CCACCATGCCTGGCTAATGTTGG - Intergenic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1018627989 6:165798858-165798880 CCACCACGCCAGGCTAATTTTGG + Intronic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1021860018 7:24896917-24896939 CCACCATGCTCGGCTAATTTTGG - Intronic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1022457037 7:30566536-30566558 CCACCATGCTTGGCTCATTTTGG + Intergenic
1022705568 7:32799052-32799074 CCACCAAGCTTGGCTTATATTGG - Intergenic
1022731394 7:33029852-33029874 CCACCATGCCCAGCCAATACTGG + Intronic
1023566829 7:41531847-41531869 CCATCATGAGAGGCTAATGCAGG + Intergenic
1023725050 7:43134656-43134678 CCACCATGCTGGGCTTCTGCAGG + Intronic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026313270 7:69206764-69206786 CCACCATGCTTGGCTAATTTTGG - Intergenic
1026320927 7:69267038-69267060 CCACCATGCCCGGCTTATATTGG + Intergenic
1026750155 7:73045414-73045436 CCACCATGCCCAGCTAATATTGG - Intergenic
1026927044 7:74201672-74201694 CCACCATGCCCGGCTAATTTTGG + Intronic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1027332799 7:77116949-77116971 CCATCATGCTCGGCTAATTTTGG - Intergenic
1028743486 7:94302170-94302192 CCACCATCCTATGCTTACACTGG + Intergenic
1029406391 7:100376631-100376653 CCATCATGCCAGGCTAACACAGG + Intronic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029639294 7:101808818-101808840 CCACCATGCCAGGCCCACACAGG + Intergenic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1031944766 7:127828147-127828169 CCACCATGCCCGGCTAATTTTGG + Intronic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033281982 7:140012609-140012631 ACACCATGCTTGGCTAATTTGGG + Intronic
1033312084 7:140268780-140268802 CCACCATGCCAGGCCTAGACTGG - Intergenic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036449189 8:8850680-8850702 CCACCAAGCGAGGCTAATTTTGG - Intronic
1036721894 8:11183516-11183538 CCACCATGCTGGGCTCAAGCTGG + Intronic
1037673389 8:21034588-21034610 CCATCATGCTCGGCTAATTTGGG + Intergenic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038336004 8:26646016-26646038 CCACCATGCCCGGCTAATTTTGG + Intronic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040445726 8:47491694-47491716 CCACCATGCCAAGCTAATACTGG - Intronic
1042318256 8:67447935-67447957 CCACCACGCCAGGCTAATTTTGG + Intronic
1043469823 8:80551141-80551163 CCACCATGCCCGGCTAATTTTGG + Intergenic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1046621554 8:116533909-116533931 CCACCATGCCCGGCTAATGTAGG + Intergenic
1046757582 8:117987933-117987955 CCACCATGCTCAGCTAATTTTGG - Intronic
1047632894 8:126727542-126727564 CCACCACACTAGGCTAATTTTGG + Intergenic
1047834648 8:128675177-128675199 CCACCATGCCAAGCTAATTTTGG - Intergenic
1050064532 9:1745051-1745073 CCACCATGGTAGGATAGTACAGG - Intergenic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051459797 9:17298954-17298976 CCACCATGCCCGGCCAATAAAGG - Intronic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052421293 9:28246269-28246291 CCACCATGCCCGGCTAATTTTGG - Intronic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052930642 9:34052610-34052632 CTACCATGCCAGGCTAATTTTGG - Intergenic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053561592 9:39201804-39201826 CCACCAGGCTAGGAGAATAGAGG + Intronic
1053825687 9:42022046-42022068 CCACCAGGCTAGGAGAATAGAGG + Intronic
1054135527 9:61417143-61417165 CCACCAGGCTAGGAGAATAGAGG - Intergenic
1054604876 9:67165347-67165369 CCACCAGGCTAGGAGAATAGAGG - Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1058453883 9:105121298-105121320 CCACCATGCCCGGCTAATTTTGG - Intergenic
1059298788 9:113296535-113296557 CCACCAGGCAAGGTTAAAACTGG + Intergenic
1059475455 9:114543188-114543210 CCACCATGCCCGGCTAATTTTGG - Intergenic
1060344074 9:122801439-122801461 CCGCCATGCTTGGCTAATTTTGG - Intronic
1060592223 9:124824713-124824735 CCACCATGCCCGGCTAATTTTGG - Intergenic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060692689 9:125678203-125678225 CCACTATGCCAGGCCAACACAGG + Intronic
1060944945 9:127564718-127564740 CCACCATGCCCGGCTAATTTTGG - Intronic
1060945066 9:127565639-127565661 CCACCATGCTTGGCTGATTTTGG - Intronic
1061200328 9:129134589-129134611 CCACCATGCACGGCCAGTACTGG + Intronic
1061748908 9:132761413-132761435 CCACCATGCTCGGCTAATTTTGG + Intronic
1061966351 9:134015927-134015949 CCACCATGCCCGGCTAATTTTGG - Intergenic
1062735335 9:138134388-138134410 CCACCATGCCCGGCTAATGGAGG + Intergenic
1062738014 9:138149230-138149252 CCACCATGCATGGCTAATTTTGG - Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185739807 X:2522615-2522637 CCACCATGCCCGGCTAATTTTGG - Intergenic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1186323720 X:8456522-8456544 CCACCATGCCCGGCTAATTTTGG + Intergenic
1187850332 X:23585434-23585456 CAACTATACTGGGCTAATACAGG + Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1190768718 X:53497533-53497555 CCACCACGCCAGGCTAATTTTGG - Intergenic
1191086716 X:56576023-56576045 CCACCATGCCCAGCTAATCCCGG + Intergenic
1192317044 X:70061299-70061321 CCACCATACTTGGCTAATTTTGG - Intergenic
1193109775 X:77716588-77716610 CCACCATGTTTGGCTAATTTTGG - Intronic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1197225184 X:123950002-123950024 CTACCATGCTAGATTAACACAGG + Intergenic
1197787045 X:130208846-130208868 CCACCATGCCCGGCTAATTTTGG + Intronic
1198098410 X:133402748-133402770 CCACCATGCTCGGCTAATTTTGG - Intronic
1198257589 X:134938017-134938039 CCACCATGCCCGGCTAATTCGGG + Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1198811785 X:140543373-140543395 TCACCATCCTGGGCTAAAACTGG - Intergenic
1200095354 X:153656992-153657014 CCACCAAGCTAGGCAGATACAGG - Intergenic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic