ID: 1054901710

View in Genome Browser
Species Human (GRCh38)
Location 9:70375854-70375876
Sequence CTACCTACAGGTAAATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054901706_1054901710 3 Left 1054901706 9:70375828-70375850 CCGGCAATTAGTATGGACCATCT No data
Right 1054901710 9:70375854-70375876 CTACCTACAGGTAAATGAGAAGG No data
1054901703_1054901710 27 Left 1054901703 9:70375804-70375826 CCTTTTGCAGTGTTAAACAGAAT No data
Right 1054901710 9:70375854-70375876 CTACCTACAGGTAAATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054901710 Original CRISPR CTACCTACAGGTAAATGAGA AGG Intergenic
No off target data available for this crispr