ID: 1054925642

View in Genome Browser
Species Human (GRCh38)
Location 9:70586038-70586060
Sequence TTCAGGAAGATGAGAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 386}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054925642_1054925646 28 Left 1054925642 9:70586038-70586060 CCTCCTGCTCTCATCTTCCTGAA 0: 1
1: 0
2: 4
3: 37
4: 386
Right 1054925646 9:70586089-70586111 CAACCCTCCCTTTCTCTGCAAGG No data
1054925642_1054925645 -2 Left 1054925642 9:70586038-70586060 CCTCCTGCTCTCATCTTCCTGAA 0: 1
1: 0
2: 4
3: 37
4: 386
Right 1054925645 9:70586059-70586081 AAACATCAGCTCATATCGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054925642 Original CRISPR TTCAGGAAGATGAGAGCAGG AGG (reversed) Intronic
900640769 1:3687175-3687197 TTCTGCAAGAGGAGAGCAGGGGG + Intronic
901754745 1:11434732-11434754 GTAAGGGAGAAGAGAGCAGGTGG + Intergenic
902464437 1:16607294-16607316 TACATGAAGATGAGAACAGTGGG + Intronic
902764970 1:18607991-18608013 TTCTGGAAGAGGAGGGAAGGTGG - Intergenic
902779233 1:18693727-18693749 TGCAGGAGGATCAGAGCGGGAGG - Intronic
903156376 1:21446413-21446435 TACATGAAGATGAGAACAGTGGG - Intronic
903375597 1:22863831-22863853 TTCAGGAGGCTGAGGGCAGAAGG - Intronic
903890935 1:26570006-26570028 AGCAGGAAGATGAGAACATGAGG + Intronic
904482240 1:30801334-30801356 TAAAGGAAGATCAGAGCAGTAGG + Intergenic
905392843 1:37649018-37649040 TTGAGGTAGATGAGAGCTGATGG - Intergenic
905735027 1:40318940-40318962 TGTTGGAAGATGAGAGCAAGAGG + Intergenic
907494653 1:54835874-54835896 TTCTGGAAGATGAGAGCAGAAGG + Intronic
907717865 1:56944360-56944382 TTCAGCAAGACAAGAGGAGGAGG - Intronic
909563595 1:77031101-77031123 TTTAGCAAGATTAAAGCAGGTGG + Intronic
911946069 1:104111028-104111050 TTCTAGAAGATGGAAGCAGGGGG - Intergenic
912000802 1:104832438-104832460 CTCAGGAAGAGGAGAGATGGTGG + Intergenic
912156656 1:106929515-106929537 TTCACGAAGTTGAGAGGAGATGG - Intergenic
912470096 1:109900957-109900979 CTGAGGAAGATGAGACCATGTGG + Intergenic
912710878 1:111948845-111948867 TTCTGGAAGGTGAGAGAAGGAGG + Intronic
913322284 1:117597340-117597362 TTCTGGAAGATGAGAGGCTGGGG + Intergenic
914730106 1:150362608-150362630 TTCGGGAGGCTGAAAGCAGGAGG + Intergenic
915225660 1:154409358-154409380 TTCAGGTGGAGGAGAGCAGAAGG - Intronic
915686908 1:157642964-157642986 TTCAGGAAGGTGACACCAGCAGG + Intergenic
916194362 1:162209750-162209772 CTCATGAAGCTGAGAGCTGGGGG + Intronic
919456654 1:197828424-197828446 TTTAAGAAAATGAGAGCAGCCGG - Intergenic
921165551 1:212504277-212504299 TACTGGAAGGTGAGACCAGGGGG + Intergenic
921567320 1:216736056-216736078 TTGAGAAAGATGAGAACAGGGGG + Intronic
921824348 1:219655379-219655401 TAAGGGAAGAAGAGAGCAGGAGG - Intergenic
921859140 1:220022861-220022883 TTCAGGGAGATGAGAAGAGAAGG - Intronic
922423931 1:225476923-225476945 TTCAGGAGGCTGAGGCCAGGCGG + Intergenic
923368783 1:233289553-233289575 TTCAGGCAGGTGAGGGCAGGAGG + Intronic
923553429 1:234981768-234981790 GTCAGGTAGATTAGATCAGGTGG + Intergenic
924300910 1:242636790-242636812 TTCATGGAGATGATGGCAGGTGG - Intergenic
924838347 1:247678482-247678504 TTCAGGAATATGAGAGTACGAGG - Intergenic
1063258221 10:4352896-4352918 TTCAGGAGGAAAAGAGCTGGAGG + Intergenic
1063578158 10:7280532-7280554 TCCAGAAATAGGAGAGCAGGTGG + Intronic
1064211961 10:13367154-13367176 TACAGGAATTTCAGAGCAGGAGG - Intergenic
1064276443 10:13910290-13910312 TGCTGGAAGATGAGAGCAGGTGG + Intronic
1064478674 10:15719127-15719149 TACAGTGAGATGAGAGAAGGGGG + Intronic
1065056926 10:21854695-21854717 TCAAGGCAGAAGAGAGCAGGTGG + Intronic
1065154294 10:22853637-22853659 CTCAGGAAGAGCAGAGGAGGTGG + Intergenic
1065563850 10:26989684-26989706 ATCAGGAAGATGGGAAAAGGGGG - Intergenic
1065563885 10:26989858-26989880 TCCAGGAAGTTCAGAGGAGGCGG + Intergenic
1066090980 10:32020168-32020190 TTCAGGAAGATGAAAGACAGAGG - Intronic
1067847344 10:49734971-49734993 TCCAGCAAGATGGGAGCAGCTGG + Exonic
1068164535 10:53311867-53311889 TTTTGGAAGAAGAAAGCAGGTGG + Intergenic
1069666146 10:70161218-70161240 CTCAGGAGGCTGAGGGCAGGAGG + Intronic
1069918973 10:71804750-71804772 GTCAGGAAGATGAAAGCTGAGGG - Intronic
1070797048 10:79222967-79222989 TTCAGCCAGGTGAGAGCAAGAGG - Intronic
1072075829 10:91972381-91972403 TTTAGGAAGGTGAGAGTGGGAGG - Intronic
1072722381 10:97789012-97789034 TGCAGGAGGGTGGGAGCAGGAGG - Intergenic
1072913625 10:99523632-99523654 TGCAGGAAGATTTGAGGAGGGGG + Intergenic
1073113370 10:101076175-101076197 TTAGGGAAGATGAGAGAAGTAGG + Intergenic
1073879429 10:107962987-107963009 TTCTTGAAGGTGAGATCAGGAGG + Intergenic
1073962102 10:108944239-108944261 TTCAGGAAGTTGAGATCATTGGG - Intergenic
1074056214 10:109924472-109924494 GTGAGGAAGGTGAGAACAGGAGG - Intergenic
1075087118 10:119421201-119421223 TTCAGGAAGGAGAGAGCCGATGG - Intronic
1076121400 10:127939781-127939803 TGCAGGCAGATGTGGGCAGGTGG + Intronic
1076121413 10:127939841-127939863 TGCAGGCAGATGTGGGCAGGTGG + Intronic
1076121467 10:127940101-127940123 TGCAGGCAGATGTGAGCAGGTGG + Intronic
1076408565 10:130230326-130230348 TTCAGGGAGATTGGAGTAGGGGG - Intergenic
1077148013 11:1054467-1054489 TCCTGGAAGATGCCAGCAGGAGG + Intergenic
1077162172 11:1118890-1118912 TTCCGGAGGCTGAGAGAAGGAGG + Intergenic
1077468061 11:2743088-2743110 TTGATGAACATTAGAGCAGGTGG + Intronic
1078179330 11:8997528-8997550 TTCAGGAAGAGTAGAGAAGCAGG - Intronic
1078268088 11:9769939-9769961 TTCTGGATAATGAGGGCAGGAGG + Intergenic
1078270004 11:9786580-9786602 TTCAGGAAGAAGAGGCCAGCAGG - Intronic
1078278574 11:9876098-9876120 TTCAGGAAGTTGAGAAAGGGAGG - Intronic
1078539932 11:12205193-12205215 TTGAGGAACATCAGAGCAGAAGG - Intronic
1080405837 11:31978075-31978097 TTCTGAAAGATGAAAGAAGGTGG - Intronic
1080432184 11:32209363-32209385 TACAGGAAGAAAAGAGTAGGGGG + Intergenic
1080740454 11:35059100-35059122 TTAAGGAAGATGAGAGAGAGGGG + Intergenic
1080768226 11:35316588-35316610 TTCAGGTAGGTGTGTGCAGGTGG + Intronic
1082220645 11:49631645-49631667 TTGAGGAAGATCAAAGCTGGAGG + Intergenic
1083750766 11:64759455-64759477 GTCAGGGAGCTCAGAGCAGGTGG - Intronic
1083903681 11:65656214-65656236 TGCAGGAAGGTGTGAGCTGGAGG - Intronic
1084111342 11:67015878-67015900 CTCAGGAGGCTGGGAGCAGGAGG + Intronic
1084467416 11:69334150-69334172 TTCAGGAAGCTGAGATGGGGTGG + Intronic
1085022832 11:73219797-73219819 TTGAGGAAGGTGAGAGTAGGAGG - Intronic
1085217978 11:74848929-74848951 TTCTGGAAGATGACAGCACCAGG + Intronic
1085332507 11:75665903-75665925 TTCAGGAAGATGAGAAATGCAGG + Intronic
1086230573 11:84564785-84564807 TTCAGGTAGCTGACACCAGGTGG - Intronic
1087383026 11:97432301-97432323 TTCATCAAGATAAGAGGAGGAGG + Intergenic
1088195644 11:107270696-107270718 CTAAGGAAGATGGGAGCAGGAGG - Intergenic
1088849719 11:113695032-113695054 TTCAGGAAACTAAGGGCAGGTGG - Intronic
1089021816 11:115223530-115223552 GTCAGTGAGATGAGAGGAGGTGG + Intronic
1090169739 11:124590334-124590356 TTCAGGAAGGTCAGAGCAGCAGG + Intergenic
1090373407 11:126272500-126272522 TTCAGGAATCTGAGACCAGCTGG - Intronic
1092951848 12:13510977-13510999 TCCATGAAGGTGAGAGCAGATGG + Intergenic
1093271385 12:17066703-17066725 TTCAAGAAGATGAGAGCTTCAGG - Intergenic
1093770458 12:23011529-23011551 TTCAGAAAAGTGAGAGGAGGAGG - Intergenic
1094363332 12:29653306-29653328 TTCAGGAAGATGGTGGCAGTGGG + Intronic
1094375031 12:29781380-29781402 TTCAGGAGGAAGAGAGCTGAGGG - Intronic
1094715520 12:33011242-33011264 TTCAGCAACATGGGAGCAGTTGG + Intergenic
1096379038 12:51139746-51139768 TTGAGGTAGAAGAGAGCAGGTGG - Intronic
1096575478 12:52550017-52550039 TACAAGAAGAGGTGAGCAGGAGG - Exonic
1096649920 12:53057385-53057407 TTGAGGCAGAGGGGAGCAGGAGG + Intronic
1096829577 12:54303957-54303979 TTCAGGAATCTGAGAGGAAGGGG - Intronic
1098538688 12:71625582-71625604 TTCAGGAGGCTGAGTCCAGGAGG + Intronic
1100705329 12:97194630-97194652 TTCACGAAGCTGAGAGGAGGAGG - Intergenic
1101589008 12:106110058-106110080 ATCAGGAAGATCAGATCAGCTGG + Intronic
1101849515 12:108391006-108391028 ATTAGGAACATGAGAGCAGCTGG + Intergenic
1101890955 12:108714652-108714674 CTCAGGAGGCTGAGGGCAGGAGG + Intronic
1102736001 12:115160144-115160166 TTCAGGGAGATGGGACCAAGAGG + Intergenic
1102784137 12:115590449-115590471 CCAAGGAAGATGAGAGAAGGTGG - Intergenic
1103346762 12:120256300-120256322 CTCAGGAGGCTGAGGGCAGGAGG + Intronic
1104717709 12:131026977-131026999 TTGAGGGAGATGAAAGCAGGCGG + Intronic
1105668531 13:22587327-22587349 CCCAGTAAGAAGAGAGCAGGCGG - Intergenic
1107409423 13:40144596-40144618 GACAGGAAGATAAAAGCAGGAGG + Intergenic
1110053917 13:70940751-70940773 TTCATGGAGATGAGATCAGGAGG + Intergenic
1111696619 13:91632473-91632495 TTATGGAAGATGAAAACAGGAGG + Intronic
1111997150 13:95176207-95176229 TCCAGGAAGCCGAGGGCAGGGGG + Intronic
1113669351 13:112164885-112164907 GTCAGGATTATGAGAGCAGTGGG - Intergenic
1113809013 13:113126336-113126358 TTCAGGGAGATGGGAAAAGGCGG + Intronic
1113895490 13:113761411-113761433 GCCAGGAAGGGGAGAGCAGGTGG + Intronic
1114244754 14:20902337-20902359 TGCAGAAGGAAGAGAGCAGGAGG - Intergenic
1114711381 14:24781676-24781698 TACAGGAAGAAGAGAGAAGGAGG + Intergenic
1114730293 14:24986040-24986062 TTGTGGAAGGTGAGAACAGGTGG + Intronic
1117429243 14:55636456-55636478 TACAAGAAGCTGAGAGAAGGTGG + Exonic
1117896506 14:60493080-60493102 TTCAGGAAGATGAAGGCAACTGG + Intronic
1118182639 14:63508407-63508429 TTCAGGAAAATGATACCAGAAGG - Intronic
1118455265 14:65940241-65940263 TTCAGTAAAAGGACAGCAGGGGG + Intergenic
1118711165 14:68520757-68520779 TTCATGAGAATGAGACCAGGTGG - Intronic
1119090165 14:71773678-71773700 TGCAGGCAGAGGAGAGCTGGGGG + Intergenic
1119789073 14:77332853-77332875 TTCAGGAGGAGGAAAGCAGTAGG + Intergenic
1122218846 14:100222430-100222452 GTCAGGAAGGTGGGATCAGGGGG + Intergenic
1122879137 14:104682205-104682227 CTCAGGAAGATGCAGGCAGGAGG + Intergenic
1124028705 15:25989915-25989937 TGCAGCCAGGTGAGAGCAGGAGG + Intergenic
1125834769 15:42739269-42739291 TTCAGGAAGAGGAGAAGAGAGGG + Exonic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1126658111 15:51002598-51002620 GTCAGGAAGAGTAGAACAGGAGG - Exonic
1126681109 15:51202975-51202997 TTCAGGATGGTGAGTGCAGATGG + Intergenic
1127661858 15:61106998-61107020 TTCAGGATGATGTGTGTAGGAGG - Intronic
1127836514 15:62795077-62795099 CTCTGGAAGAGGAGAGCAGGGGG + Intronic
1128218069 15:65947901-65947923 ATCAGGAACATGACAGCAAGAGG + Intronic
1128388977 15:67170163-67170185 CTCAGGAAAATGAGAGGAGCAGG - Intronic
1128671652 15:69578362-69578384 TTCAGGAAGAGAAGAGGAGGTGG + Intergenic
1129657959 15:77537182-77537204 TCCAGAAAGCTGAGGGCAGGGGG - Intergenic
1129879180 15:78995941-78995963 ATCAGGAAGAAGAGTGAAGGAGG - Intronic
1130567911 15:85013709-85013731 TTCAGGAATTTGAGAGAAGCGGG + Intronic
1131450248 15:92533318-92533340 TTAAAGAAGTGGAGAGCAGGGGG + Intergenic
1132302262 15:100783295-100783317 TTGAGGCAGATGGGAGCATGGGG + Intergenic
1132593579 16:737746-737768 CACAGGAAGAGGAGAGCAGAGGG + Intronic
1132768902 16:1550043-1550065 TTCAGGAGGCTGAGCCCAGGAGG - Intronic
1134081115 16:11325814-11325836 TGCTGGAAGATGAGACCATGAGG - Intronic
1134887195 16:17804128-17804150 ATACGCAAGATGAGAGCAGGTGG - Intergenic
1135020198 16:18956623-18956645 TTGAGGAGGCTGAGAGGAGGTGG - Intergenic
1135487869 16:22881643-22881665 CTCAGCAAGGTGAGGGCAGGAGG + Intronic
1137253937 16:46759938-46759960 TTCAGTGAGATTAGAGCATGTGG - Intronic
1137512945 16:49117179-49117201 TCAAGGAAGAAGAGAGCTGGAGG - Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1139824013 16:69742697-69742719 TGCAGGCAGATGACAGCGGGTGG + Intronic
1140387971 16:74559333-74559355 CTCAGGAGGCTGAGGGCAGGAGG + Intronic
1140558768 16:75952936-75952958 CTCAGGAAGATGTGAACAGAAGG + Intergenic
1140698854 16:77562521-77562543 TACAGAAAGATTAGAGCAGATGG + Intergenic
1142022702 16:87794037-87794059 TTCAGGAATTTGAGACCAGCCGG + Intergenic
1142223075 16:88864810-88864832 TCCAGGAACATGAGCGCAGAGGG - Intronic
1142343685 16:89540121-89540143 TTCTGTGAGACGAGAGCAGGTGG + Intronic
1142427915 16:90010659-90010681 TTTTGTCAGATGAGAGCAGGAGG + Intronic
1142713943 17:1737928-1737950 AGCAGGAAGTTAAGAGCAGGAGG + Exonic
1142783475 17:2200837-2200859 TTCAGGAATTTGAGACCAGGAGG - Intronic
1143472353 17:7183883-7183905 GGCAGGGAGATGAGATCAGGAGG + Intergenic
1145863998 17:28228448-28228470 TTCAGCGAGATGAGAGAGGGCGG - Intergenic
1146629916 17:34462535-34462557 TTCAGTAAGATGAGAGGAATAGG - Intergenic
1148713549 17:49699394-49699416 TGTAGGAAGATGAAAGGAGGAGG - Intergenic
1148962142 17:51402126-51402148 TGCATGCTGATGAGAGCAGGTGG - Intergenic
1150630525 17:66877324-66877346 TCCAGGAAGATGAGTGCCTGCGG + Exonic
1151277417 17:73046123-73046145 TTGAGGGAGATGAGTGAAGGGGG - Intronic
1151961694 17:77409110-77409132 CTCAGGAAAATGGGAGGAGGTGG - Intronic
1152089551 17:78239193-78239215 TCCAGGCAGCTGAGAGCAGGAGG - Exonic
1152742074 17:82022812-82022834 TTCCGGAAGGTGAGGGCCGGAGG - Exonic
1153289832 18:3489804-3489826 TTCAGGAACATGGGTGCAGCTGG - Intergenic
1154484707 18:14864653-14864675 AAGAGGATGATGAGAGCAGGAGG - Intergenic
1154939141 18:21093582-21093604 TGCAGGAAAATGAGGGCAGTAGG - Intronic
1155039190 18:22050704-22050726 ATAAGGAAGATGAGAGCAGAAGG - Intergenic
1155325033 18:24656592-24656614 TGCAGGATGCCGAGAGCAGGTGG + Intergenic
1156399719 18:36729333-36729355 CTCAGGAAGTTGGGTGCAGGTGG - Intronic
1156501505 18:37562479-37562501 TTAAGGAAGGGGAGAGCAAGAGG + Intronic
1156691480 18:39712412-39712434 TTCAGGAATATGACAACATGTGG - Intergenic
1156820110 18:41362014-41362036 TTCTTGAAGAGAAGAGCAGGTGG + Intergenic
1157626619 18:49056130-49056152 TTCAGGAAAGTGGGAGCAGAGGG - Intronic
1158278797 18:55798250-55798272 TTCAGGCAGATGATACCAGATGG - Intergenic
1158530686 18:58257035-58257057 TTCAGAAAAATAAAAGCAGGGGG - Intronic
1159001741 18:62981018-62981040 TTAGGGAAGATGTGAGAAGGGGG + Intergenic
1159073160 18:63648486-63648508 CTAAGGCAGATGAGAGCAGGAGG - Intronic
1159766758 18:72501005-72501027 TACAGGAAAATGAAAGTAGGTGG - Intergenic
1160139285 18:76306398-76306420 TTAAGGAAGATGTTAGCAGTAGG + Intergenic
1163083338 19:14959668-14959690 TTCAGGAAGGTGAGAGCATGGGG - Intronic
1163924496 19:20326794-20326816 TTCAGGAAATTGTGAGCAGCAGG - Intergenic
1166426233 19:42680859-42680881 GGCAGGAAGAAGAGAGCAAGGGG - Intronic
1166995674 19:46718642-46718664 TTCAGGAAAAAGGGTGCAGGTGG - Intergenic
1167701171 19:51046956-51046978 AACAGGAAGAGGAGGGCAGGTGG + Intergenic
1168228978 19:55016672-55016694 TTGAGGAATAAGAGAGCTGGAGG - Intronic
1168677701 19:58290943-58290965 TTCAGGAGGCTGAGCCCAGGAGG + Intronic
926706005 2:15838032-15838054 TTCAGGGCAATGAGACCAGGTGG - Intergenic
927929377 2:27034314-27034336 TTAGAGAAGATGAGAGGAGGGGG + Intronic
928177321 2:29043587-29043609 GTCAGGTAGGTGAGGGCAGGTGG - Intronic
928396267 2:30945275-30945297 CTCAGGAAGGTGTGAGCAGGAGG + Intronic
928652925 2:33421240-33421262 TTCATGAAGATCAGAGCAACTGG + Intergenic
929314610 2:40462509-40462531 TTAGAGAAGATCAGAGCAGGCGG + Intronic
929541165 2:42823391-42823413 ATTAGGAAGACAAGAGCAGGTGG - Intergenic
930996208 2:57721676-57721698 ATCAGGAAGAAAAGAGCAGAAGG - Intergenic
931418298 2:62101932-62101954 TTCAGGGAGAGGAGAGGAGATGG - Intronic
931434700 2:62236323-62236345 TCCAGGAATGTGACAGCAGGGGG - Intergenic
931942836 2:67271924-67271946 TTCAGGAAGAGAAGTGCTGGAGG - Intergenic
932188554 2:69719368-69719390 CTCAGGAGGCTGAAAGCAGGAGG - Intronic
932374602 2:71224636-71224658 TTCAGGAAGTCTAGAGCAGTAGG + Intronic
932403070 2:71495652-71495674 TGCAGGAAGATGGGAGGAGTGGG - Intronic
932844876 2:75124798-75124820 TACAGGAAGCGAAGAGCAGGAGG + Intronic
932909200 2:75788239-75788261 TTCAGGAACATGGCAGCAGGTGG + Intergenic
933108173 2:78360023-78360045 ATCAGGAAGATGAAATCAGCTGG + Intergenic
934536895 2:95141588-95141610 TTTAGGAAGATGCGGGAAGGTGG - Intronic
934551128 2:95262514-95262536 TAAAGGAAGTTGAGACCAGGAGG + Intergenic
934658903 2:96132723-96132745 TGCAGGGTGATGAGAGCAAGTGG + Intronic
935103828 2:100021050-100021072 ATCAGGAGGAAGAGGGCAGGTGG - Intronic
935416054 2:102820630-102820652 TTCAGGGAGAAGGGAGCAAGTGG + Intronic
935626501 2:105176169-105176191 ATCATTAAGATGAGAGCATGCGG - Intergenic
935763669 2:106343735-106343757 CTCAGGATGTGGAGAGCAGGAGG - Intergenic
935942398 2:108254299-108254321 TTGAGTCAGATGAGAGCATGTGG - Intronic
936159888 2:110076937-110076959 TTTAGGAAGAAGGGAGCATGGGG - Intergenic
936175685 2:110218386-110218408 TTCACGGAGCAGAGAGCAGGAGG - Intergenic
936184776 2:110294416-110294438 TTTAGGAAGAAGGGAGCATGGGG + Intergenic
936344612 2:111665774-111665796 TTTAGGAAGAGGAGTGGAGGAGG - Intergenic
936908131 2:117561229-117561251 TTCAGGCAGGTGGGAGCTGGTGG + Intergenic
937266046 2:120615219-120615241 TGCAGGAAGAGGAGGGCAGGGGG - Intergenic
937647063 2:124277263-124277285 ATAAGGAAAATGAGACCAGGAGG - Intronic
938149044 2:128865432-128865454 TCCAGGGAGATGAAAGCAGTTGG - Intergenic
938257757 2:129873192-129873214 TTCAGGGAGAGGAGAGCAGAAGG - Intergenic
938403022 2:131009179-131009201 TTCAGAAAAATGAAAGAAGGAGG - Intronic
938984371 2:136559790-136559812 TGCAGGAAGAGGAAAGCAGATGG - Intergenic
939119324 2:138097992-138098014 TTCAGAATGATGAGAGGAAGAGG - Intergenic
942180241 2:173373319-173373341 TTTGGGAAGCTGAGGGCAGGTGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943900140 2:193423343-193423365 TTCAAGGAGATGAGAGCAGGGGG + Intergenic
943960195 2:194254356-194254378 GGCAGGATGATGGGAGCAGGAGG + Intergenic
944301571 2:198130254-198130276 TGTAGGAAGAAGAGAGAAGGGGG - Intronic
944849615 2:203705229-203705251 TGCCGGAAGAAGAGAGCAGTTGG + Intergenic
945576571 2:211537588-211537610 TTCAGGAAAACAAGAGAAGGTGG + Intronic
946305331 2:218853807-218853829 TTCAGGAAGAGGAAAGTGGGCGG - Intergenic
946701992 2:222424070-222424092 TGCAGGAAGGTGAGAGTACGTGG + Intergenic
948233752 2:236371175-236371197 TTCTAGAAGATGAGAGAGGGTGG - Intronic
1170549564 20:17465298-17465320 TACAGGAAGCAGAGAGCAAGAGG - Intronic
1170845991 20:19962417-19962439 TTCTGGAAGAGGAGAGGAAGTGG - Intronic
1171310833 20:24143502-24143524 TTGTTGAAGATGGGAGCAGGTGG + Intergenic
1172201850 20:33132318-33132340 TTGAGGAACGTCAGAGCAGGAGG - Intergenic
1172873363 20:38149294-38149316 TCCAGGAAGATGAGACCTAGAGG - Intronic
1173784513 20:45782970-45782992 TAAAGGAAGAAGAGAGAAGGAGG - Intronic
1174567393 20:51475405-51475427 TTCATGGAGAAGCGAGCAGGGGG - Intronic
1174627549 20:51927926-51927948 TGCAGGGAGAGGACAGCAGGGGG + Intergenic
1175337138 20:58204002-58204024 TTCATGAAGGTGAGAAGAGGTGG + Intergenic
1176006993 20:62870864-62870886 TACAGGAGGATGAGAGGAAGGGG - Intergenic
1178978625 21:37242475-37242497 CTCAGGAAGCTGAGGGCAGGAGG + Intronic
1180034576 21:45237989-45238011 GTCAGGCATTTGAGAGCAGGAGG + Intergenic
1180066596 21:45415544-45415566 TTCCGGAAGATGGATGCAGGTGG + Intronic
1181284118 22:21739827-21739849 ATCAGGAGGGTGAGGGCAGGTGG - Intergenic
1182239485 22:28903662-28903684 TTCAGGAATGTTAGAGGAGGAGG - Intronic
1182370378 22:29806292-29806314 TGCAGGCAGATGAGAGCAGATGG + Intronic
1182860506 22:33555579-33555601 TACAGGAACATCAGAGCAGAGGG + Intronic
1184193233 22:42908903-42908925 TTATGGAGTATGAGAGCAGGAGG - Intronic
1184559860 22:45256013-45256035 TGCAGGAGGATGAGATCTGGGGG - Intergenic
1185074437 22:48675759-48675781 TTGAAGAATAAGAGAGCAGGAGG - Intronic
950460806 3:13121316-13121338 TTCAGGTAGCTGGGAGGAGGAGG - Intergenic
952650328 3:35719065-35719087 TCCAGGAAGATGATAGCAATGGG - Intronic
953363719 3:42323734-42323756 TTCAGGAAGAGGACAGCACCTGG - Intergenic
954466844 3:50660281-50660303 TGGAGGAAGAAGAGAGTAGGTGG + Intergenic
957304241 3:78436319-78436341 TTATGGAAGATGGGAGTAGGAGG - Intergenic
957853300 3:85839622-85839644 TTCAGGAAGATGAGGGGAAGTGG + Intronic
958763282 3:98334101-98334123 TTCAGGGAGATTAGGGCATGGGG - Intergenic
958972808 3:100631551-100631573 TGCAGGAAGATGTGAGAAGTAGG - Intronic
959381437 3:105645508-105645530 ATCAGGAAGATGGCAGCAGTTGG + Intergenic
960198578 3:114802517-114802539 TTCAGGCATGTGAGAGGAGGGGG - Intronic
961046208 3:123709818-123709840 TGCAGGAAGATGGGTGCAGTGGG + Exonic
961226271 3:125250650-125250672 TCCAGGTAGATGACAGCAGTTGG + Intronic
963967515 3:151389293-151389315 TTCAGGAAGAATAGAGGAAGAGG - Intronic
964009109 3:151868399-151868421 CTCAGGAGGCTGAGGGCAGGAGG + Intergenic
964683658 3:159370218-159370240 ATCGGGGAGATGAGAGGAGGAGG - Intronic
965070035 3:163907991-163908013 TTCAGGGAGCAAAGAGCAGGAGG - Intergenic
965422338 3:168476928-168476950 GTCAGCAAGAGGAGAGCACGTGG + Intergenic
968293727 3:197557400-197557422 TACAGGAAGATGAAAACAGGAGG + Intronic
969614851 4:8246376-8246398 TTAAGGAAGAAGGGAGAAGGAGG + Intergenic
969706890 4:8816680-8816702 TTAAGGATGATGAGTGGAGGGGG + Intergenic
971170054 4:24224781-24224803 TTCAGGGAGATGAGAGTATTTGG + Intergenic
971728666 4:30347834-30347856 TTCAGGAAGAAGGGAGAAAGTGG + Intergenic
973010532 4:45067426-45067448 TTCAGGAAAATGAATGCAGAAGG - Intergenic
973567238 4:52200715-52200737 TTCAAGCAGATGAGTGAAGGAGG + Intergenic
973794025 4:54405681-54405703 TTTAGGAATAGGAGAGCTGGTGG - Intergenic
974378679 4:61109473-61109495 TCCAGGAGGGTGGGAGCAGGAGG - Intergenic
974864225 4:67560971-67560993 GTCAGGGAGAAGAGAGCAAGAGG + Intronic
975448652 4:74499574-74499596 GTCAGGAAGACAAGAACAGGAGG - Intergenic
976150352 4:82085092-82085114 TTCCAAAAGATAAGAGCAGGAGG + Intergenic
976510828 4:85907994-85908016 TGGAGGAAGTTCAGAGCAGGTGG + Intronic
978028284 4:103905755-103905777 TTCAGGAAGATGAAATCACTGGG - Intergenic
978479070 4:109167868-109167890 TTCAGATAGATGAGGGGAGGTGG + Intronic
978754579 4:112287958-112287980 CTGATGAACATGAGAGCAGGTGG + Intronic
979463072 4:121005108-121005130 TGCAAGAAGATGAGCACAGGAGG - Intergenic
982156899 4:152532587-152532609 TTTAGGAAGAAAAGAGCAAGTGG - Intronic
985000329 4:185476063-185476085 TTCTGGAAGATTGAAGCAGGGGG - Intergenic
985793272 5:1943976-1943998 TGCAGGAAGAGGACAGCACGAGG - Intergenic
986292507 5:6411422-6411444 CTCAGGCTGATGAGACCAGGAGG + Intergenic
988909630 5:35826403-35826425 CTCAGGAACAAGAGAGCATGGGG + Intergenic
988985365 5:36613544-36613566 TTCAGGAAGTTGAGAGGTGTGGG - Intronic
989156428 5:38348800-38348822 ATCAGGACAATGAGAGGAGGGGG + Intronic
990395243 5:55371423-55371445 TCGAGGAAGATGAGAGATGGTGG - Intronic
991568169 5:68026704-68026726 CTCAGGAAGATGAGAACCTGTGG + Intergenic
993135563 5:83957275-83957297 CAGAGGAAGATGATAGCAGGGGG - Intronic
994724549 5:103418853-103418875 TTCAGGAAAATGTGTGCAGATGG - Intergenic
995152938 5:108872158-108872180 TTCAGGCAAATGAGATCATGTGG + Exonic
995240023 5:109875151-109875173 TGCCAGAAGATGAGAGCAAGAGG + Intergenic
995747045 5:115415100-115415122 TTTAGGAAAATGGGAGCAAGTGG - Intergenic
996338433 5:122410468-122410490 TTCATAAAGATGGGGGCAGGAGG + Intronic
996457248 5:123698962-123698984 GTCAGGGAGGTGAGGGCAGGGGG - Intergenic
997876946 5:137558065-137558087 GTGAGGAGGGTGAGAGCAGGGGG + Intronic
998007160 5:138664753-138664775 TTAAGGAAGCTGAGAACAGAGGG - Intronic
1000556990 5:162738231-162738253 TTCATGACAATGACAGCAGGAGG + Intergenic
1000655213 5:163869749-163869771 TTCATGCAAATGAGAGCAGGGGG + Intergenic
1001024181 5:168209485-168209507 TTCAGGAGGATGAGCTCATGTGG - Intronic
1001103658 5:168834582-168834604 CTCAGGAGGCTGAGGGCAGGAGG + Intronic
1001140374 5:169139010-169139032 TTCAGGAAGCTGAGAAAAGAGGG - Intronic
1001905427 5:175468435-175468457 TGAAGGAAGAGGAGAGCAGAGGG - Intergenic
1002709601 5:181187248-181187270 CTCAGGAAGCTGAGCCCAGGAGG - Intergenic
1002815789 6:678608-678630 TTAAGAAAGATGAAAGCAGCAGG + Intronic
1002869047 6:1149014-1149036 TTCAGGGAGTTCAGAGCATGAGG + Intergenic
1003000375 6:2326097-2326119 AACAGGAAGAAGAGAGCTGGGGG - Intergenic
1003040325 6:2682017-2682039 TTGAGCAGGAGGAGAGCAGGAGG - Intronic
1003584688 6:7376697-7376719 TCCAGGAAGATCAGAGTTGGAGG - Intronic
1004747324 6:18524009-18524031 TTCAGAAAGATGAGGGTAGCCGG + Intergenic
1004868710 6:19880994-19881016 TTTACAAAGATGAGAGCACGAGG + Intergenic
1005346681 6:24897382-24897404 TTCAGGGTGAAGAGAGAAGGGGG + Intronic
1005879785 6:30047320-30047342 AGCAGGAAGAAGAGAGAAGGGGG + Intergenic
1006257039 6:32840196-32840218 TAGAGGAAGAAGAGATCAGGAGG - Intergenic
1006411473 6:33876489-33876511 TGCAGGATGCTGAGGGCAGGCGG - Intergenic
1006563968 6:34938293-34938315 TTTTGGAATAAGAGAGCAGGAGG + Intronic
1006850386 6:37093765-37093787 GTCAGGAAGCCCAGAGCAGGAGG + Intergenic
1007446103 6:41907360-41907382 TTGGGGAAGATGGGAGCAGGAGG - Intronic
1007463181 6:42032811-42032833 TACAGGAAGATGAGGGCAGCTGG - Intronic
1007808821 6:44472134-44472156 ATCAGGAAGAGGAAAGGAGGTGG - Intergenic
1007985924 6:46206722-46206744 TTCAGGAAGATCAGGTCAGGGGG - Intergenic
1008063794 6:47026378-47026400 TTCAAGGAGATCAGAGCTGGGGG - Intronic
1008930839 6:56938240-56938262 CTCAGGAAGCTGAGATAAGGAGG - Intronic
1010587233 6:77667806-77667828 TTCAGAATCATGAGAGCAAGTGG + Intergenic
1012369463 6:98485748-98485770 TGAAGGCAGATCAGAGCAGGAGG - Intergenic
1012405523 6:98892769-98892791 TTCATGAAGATAAAAGCAGAGGG + Intronic
1012658471 6:101856047-101856069 TTCACCAAGATGAGAGCAAGTGG + Intronic
1012761727 6:103310528-103310550 TTCAGGTAGATCAGAACAGAGGG + Intergenic
1014344685 6:120253194-120253216 GTCAGGAAGTGGAGGGCAGGGGG + Intergenic
1014398741 6:120960546-120960568 TACAGGTAGATGGGAACAGGTGG - Intergenic
1015116248 6:129652506-129652528 TTCAAGAATATGAGGGGAGGTGG - Intronic
1016258952 6:142144760-142144782 TTTAGAAAGAAGAGAGCATGAGG + Intergenic
1016903002 6:149120537-149120559 ATCAGGAAAATGAGAGGTGGAGG - Intergenic
1017271847 6:152516219-152516241 TTCAGGGAGATGTGGGGAGGAGG + Intronic
1017470194 6:154731800-154731822 TTCAGGAAGATTGAAGGAGGAGG + Intergenic
1018996706 6:168715731-168715753 TTGAGGATGATGGGAGGAGGAGG + Intergenic
1019812230 7:3173180-3173202 GGCAGGAAGATGACAGCTGGGGG + Intronic
1019890402 7:3941522-3941544 TTCAGGAATAGGAGAAAAGGAGG - Intronic
1019921305 7:4164851-4164873 TGCAAGAAGACCAGAGCAGGAGG + Intronic
1020191213 7:5999545-5999567 CTCAGGAGGCTGAGGGCAGGAGG + Intronic
1022734064 7:33059915-33059937 TTTATGAAGATGAGATAAGGTGG - Intronic
1023358795 7:39395053-39395075 TGGAGGCAGATGAGAACAGGAGG - Intronic
1025937192 7:66046856-66046878 CTCTGGAAGATGAAGGCAGGTGG + Intergenic
1026136036 7:67661769-67661791 TTCAGGAATAACAGAGCAGCCGG - Intergenic
1026706467 7:72698141-72698163 CTCAGGAGGAAGAGAGGAGGAGG + Intronic
1028017750 7:85736500-85736522 TTCTGAAAGAGGAGAGGAGGTGG + Intergenic
1028387448 7:90273246-90273268 TTCAGTATGATGAGAGCAGAAGG + Intronic
1028669379 7:93383670-93383692 TTCGGGGAGAAGAGAGCATGAGG + Intergenic
1029263678 7:99322263-99322285 GTCAGGATGGTGGGAGCAGGGGG + Intergenic
1029453282 7:100654823-100654845 TAGAGCAAGAAGAGAGCAGGAGG + Intronic
1032129100 7:129214390-129214412 CTCAGGATTATGAGAGAAGGAGG + Intergenic
1032286650 7:130542622-130542644 TTCTGGAAGATGACAGTGGGAGG + Intronic
1032341795 7:131080620-131080642 TTTGGGAGGCTGAGAGCAGGTGG - Intergenic
1032963403 7:137067122-137067144 TTTTGGAAGATGAAAGCAAGTGG + Intergenic
1034679238 7:152915934-152915956 CCCAGGAAGCTGAGTGCAGGAGG + Intergenic
1035063775 7:156090851-156090873 TTCTTGAAGATTGGAGCAGGAGG + Intergenic
1035315181 7:157993070-157993092 TTCAGGAGGATCATCGCAGGTGG + Intronic
1035947312 8:3979567-3979589 TACAGGAAGATGGGATCATGAGG + Intronic
1036443350 8:8800771-8800793 TCCAGGCAGATAAAAGCAGGTGG - Intronic
1037583538 8:20261163-20261185 TTCAGGAAGGGGACAGGAGGAGG + Intronic
1037662175 8:20937326-20937348 TCCAGAGAGATGGGAGCAGGAGG + Intergenic
1037691271 8:21183402-21183424 ATAAGGAAGAGGAGAGGAGGAGG - Intergenic
1038219982 8:25598225-25598247 TTCAAGTAGATGAGAGAAGTGGG - Intergenic
1038703088 8:29869289-29869311 GTCAGCAAACTGAGAGCAGGAGG + Intergenic
1038776051 8:30531621-30531643 TTCAGGAATGAGAGGGCAGGAGG + Intronic
1039697675 8:39929926-39929948 TTATAGAAGATGAGAGGAGGGGG + Intergenic
1041761281 8:61369550-61369572 TTCATGAAGATGATAGTAGCAGG - Intronic
1043375641 8:79646544-79646566 TTCAAAATGATGAGAGCAGCAGG + Intronic
1044778119 8:95714982-95715004 GTTTGGAAGATGGGAGCAGGAGG - Intergenic
1044944873 8:97380548-97380570 TTCAGGAAGCTGAGATCACTAGG - Intergenic
1045760722 8:105603749-105603771 TTTAAGAAAATGAAAGCAGGTGG + Intronic
1047040055 8:120983438-120983460 TTCACGAAGGTGAGAGCACTGGG - Intergenic
1047561066 8:125988588-125988610 AACAGGAAGATGAGAGGAAGAGG + Intergenic
1048136999 8:131756301-131756323 ATCAGGAAGATGTGAGGAGTGGG - Intergenic
1048164103 8:132046860-132046882 TTCAGGAAGATGCCCCCAGGTGG + Intronic
1048204539 8:132404760-132404782 CTCAGGAGGATGAGACAAGGAGG + Intronic
1048399659 8:134052606-134052628 TACAGGAAGAAGAGAGAATGGGG + Intergenic
1048613820 8:136052722-136052744 GTCATGAAGATGAAAGCAAGTGG - Intergenic
1048909340 8:139119610-139119632 TTCAGGAATATGAGCCCAGATGG - Intergenic
1049336980 8:142091882-142091904 TTGGGGAAGAGGAGTGCAGGGGG - Intergenic
1049940831 9:544744-544766 TTGGGGAAGAGGAGAGGAGGGGG + Intronic
1050061274 9:1712083-1712105 TACAGGCAGATGGAAGCAGGGGG + Intergenic
1051207387 9:14702703-14702725 ATTATGAAAATGAGAGCAGGAGG + Intergenic
1051937178 9:22457336-22457358 TTCAGGATGAAGGGAACAGGAGG + Intergenic
1052337358 9:27333847-27333869 TTCAGCAGGAGGTGAGCAGGGGG - Intronic
1054731855 9:68708992-68709014 GTCACAAAGATGATAGCAGGAGG + Intronic
1054925642 9:70586038-70586060 TTCAGGAAGATGAGAGCAGGAGG - Intronic
1055688403 9:78803468-78803490 TTAAAGAACATGAGAGTAGGTGG + Intergenic
1056051649 9:82775403-82775425 TTCAGTAAGGTAAGAGCAGAGGG - Intergenic
1056123521 9:83512664-83512686 TTCAAGAAGAGGTGAGCAGAAGG - Intronic
1056147569 9:83748301-83748323 TTCAGGAAGGTGAAAGTAAGTGG - Exonic
1056510212 9:87297417-87297439 TTCATGAACATAAGAGCTGGAGG - Intergenic
1058702765 9:107614542-107614564 CTCAGGATGAGGAGAGGAGGAGG - Intergenic
1059354856 9:113690784-113690806 TTCAGGGAGATGAGGGGAAGGGG - Intergenic
1060106983 9:120878675-120878697 GTGAGGCAGGTGAGAGCAGGGGG - Intronic
1060948512 9:127585718-127585740 CTCAGGAGGCTGGGAGCAGGAGG - Intergenic
1061324319 9:129853766-129853788 TTAGGGAATCTGAGAGCAGGGGG + Intronic
1185432662 X:18752-18774 GTCTGGAAAATGGGAGCAGGGGG - Intergenic
1185442013 X:231574-231596 GTCTGGAAAATGGGAGCAGGGGG - Intergenic
1187234447 X:17453932-17453954 TTAAAGAAGATGGCAGCAGGGGG + Intronic
1188286004 X:28326263-28326285 CTCAGAAAGATGAGACCTGGGGG + Intergenic
1188706468 X:33338953-33338975 TTCAGGTAGATGATGACAGGGGG - Intronic
1188706505 X:33339349-33339371 TTCAGGAAGATGACAGAATCAGG - Intronic
1189534767 X:41924174-41924196 TTAATGAAGATGAGGGCTGGGGG + Intergenic
1189932667 X:46031438-46031460 TTCATTTGGATGAGAGCAGGGGG - Intergenic
1192903455 X:75523839-75523861 TCCAGGCAGATGAGAGGAGGAGG + Intergenic
1195615520 X:106909068-106909090 TTAAGGAGGCTGAGAGAAGGTGG + Intronic
1196934202 X:120713420-120713442 AACAGGAAGAAGAGAGAAGGGGG - Intergenic
1197188627 X:123619293-123619315 TTCAGTAAGCTGAGATCAGTGGG - Intronic
1197999019 X:132412452-132412474 TTTAGGAAAATCACAGCAGGTGG + Intronic
1199698550 X:150360883-150360905 CTGAGGAAGATGAGAGCAAGTGG + Intergenic
1200214965 X:154364168-154364190 GTCAGGCAGATAGGAGCAGGTGG + Intronic