ID: 1054927331

View in Genome Browser
Species Human (GRCh38)
Location 9:70601847-70601869
Sequence CATGATAAGCAGAAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 4, 3: 28, 4: 384}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054927331_1054927338 -2 Left 1054927331 9:70601847-70601869 CCTTCCCTTTTCTGCTTATCATG 0: 1
1: 1
2: 4
3: 28
4: 384
Right 1054927338 9:70601868-70601890 TGGGGAAGGAATATGCGTCTAGG No data
1054927331_1054927339 24 Left 1054927331 9:70601847-70601869 CCTTCCCTTTTCTGCTTATCATG 0: 1
1: 1
2: 4
3: 28
4: 384
Right 1054927339 9:70601894-70601916 TAAATCGCTCGAGTGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054927331 Original CRISPR CATGATAAGCAGAAAAGGGA AGG (reversed) Intronic
900764435 1:4494540-4494562 CATAAAGAGGAGAAAAGGGAGGG - Intergenic
900774943 1:4575799-4575821 AATGATAAACAGTGAAGGGAAGG - Intergenic
901328738 1:8388010-8388032 CATCAACAGCAGAAAAGAGAAGG + Intronic
902799064 1:18818319-18818341 CATGCAAATCAGAGAAGGGAAGG + Intergenic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
904444958 1:30563377-30563399 CATTTGAAACAGAAAAGGGAGGG + Intergenic
904538095 1:31214714-31214736 CAGGATAAGGAGGAAAGGGAGGG + Intronic
905287936 1:36896563-36896585 CATGAAAGGCAGAAAAGGGCTGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906224785 1:44112713-44112735 AAAGATGACCAGAAAAGGGAAGG - Intergenic
906559226 1:46742897-46742919 TATTAGAAGCTGAAAAGGGAGGG + Intergenic
907117182 1:51979195-51979217 CATGAAAAGCTGAAAAGTTAAGG - Intronic
907462522 1:54613430-54613452 CATGAAGGGAAGAAAAGGGAGGG - Intronic
907539385 1:55198997-55199019 CATGATAACCAGGACAGGCATGG + Intronic
908060670 1:60344918-60344940 CATAAAAACCAGAAAAGGGAGGG + Intergenic
908126152 1:61032022-61032044 CAGAATATGTAGAAAAGGGACGG + Intronic
909050685 1:70764228-70764250 CATGATAAGCAGAGAAGGAGAGG + Intergenic
909839876 1:80306687-80306709 CAATATAAACTGAAAAGGGAAGG - Intergenic
910034065 1:82768943-82768965 CATGATAAACTGAAAATTGAAGG + Intergenic
911666169 1:100555393-100555415 CATGATAATCACAAAATAGAAGG - Intergenic
913104282 1:115597381-115597403 CATGATAAGGGGAAAAGAGGAGG + Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913426288 1:118734517-118734539 TAGGCTAAGCAGAAAAGGTAAGG + Intergenic
913579609 1:120213234-120213256 CAAACTAAGCACAAAAGGGAAGG + Intergenic
913628564 1:120685154-120685176 CAAACTAAGCACAAAAGGGAAGG - Intergenic
914561543 1:148824661-148824683 CAAACTAAGCACAAAAGGGAAGG + Intronic
914611289 1:149305547-149305569 CAAACTAAGCACAAAAGGGAAGG - Intergenic
915335410 1:155138095-155138117 CATGGTAAGCACAACTGGGATGG + Exonic
916397278 1:164404977-164404999 AATGAGAAGCAGAAAAGTGAAGG - Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917643737 1:177008939-177008961 CATGGAAACCAGCAAAGGGATGG + Intronic
917772347 1:178293548-178293570 CTTAATAGGGAGAAAAGGGATGG - Intronic
917964317 1:180168910-180168932 CATGAAGAGCTGAAAAGCGAGGG + Intronic
918261153 1:182797532-182797554 CATGAAAGGCAGAAGAGGTATGG - Intronic
918586234 1:186192177-186192199 GATGACTAGCAGAAAGGGGAAGG + Intergenic
918596780 1:186303498-186303520 ACTGAGAAGCGGAAAAGGGAAGG + Intronic
919473953 1:198011509-198011531 CAGCATAAGCAAAAAAGGGGAGG + Intergenic
919814989 1:201431568-201431590 CCTGATGAGCAGCAAAGAGATGG - Intergenic
921303746 1:213774694-213774716 CAAGCAAAGCATAAAAGGGAAGG - Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921858871 1:220019422-220019444 CATGAGAATCAGAAAAAAGATGG + Intronic
921945529 1:220883640-220883662 CATGGGAAGCAGAAAGGGAAAGG - Intronic
923889734 1:238199704-238199726 CAGCAAAAGCAAAAAAGGGAGGG - Intergenic
924254045 1:242164529-242164551 CACTATAAGCAAAAAAGGAAAGG + Intronic
924724261 1:246653629-246653651 CATGATAAAAACAAAAGGCAAGG - Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065954606 10:30682890-30682912 AATCATAAGCAGAAAAGTTAGGG + Intergenic
1066696452 10:38083026-38083048 CATGAGAATTAGGAAAGGGAAGG + Intergenic
1066996099 10:42564710-42564732 CATGAGAATTAGGAAAGGGAAGG - Intergenic
1067986752 10:51156249-51156271 CATGATAAGGAGATAAGAGAAGG + Intronic
1071936827 10:90541367-90541389 CAGGTTAAGCAGAACAGGCAGGG + Intergenic
1072464085 10:95647067-95647089 CATGATAAGCAGAATAGCAGAGG - Intronic
1072621897 10:97085361-97085383 CATGCTAAGAAGAAAAAGCATGG - Intronic
1073007182 10:100333446-100333468 CAAAATAAGAAGAAAAGGAAGGG + Intergenic
1074293191 10:112157057-112157079 CATTTTAAGTAGAAAAGGAAAGG - Intronic
1075846519 10:125549314-125549336 CATCTTTTGCAGAAAAGGGATGG + Intergenic
1076181398 10:128411707-128411729 CAGAAAAGGCAGAAAAGGGAGGG + Intergenic
1078627621 11:12971839-12971861 CCTGATAAGCAGAGTAGGCATGG - Intergenic
1079271248 11:18987912-18987934 CATGAAAAGGAGAAACGGGGCGG + Intergenic
1079353028 11:19709175-19709197 CATAATAACCAGACAAGGGTGGG - Intronic
1079613476 11:22462090-22462112 GATGATGAGGAGAAATGGGAAGG - Intergenic
1081025026 11:38001400-38001422 TCAGATAAGCAGAAAAGTGAAGG - Intergenic
1081272871 11:41108096-41108118 CCTGATAAGCACTAAAGGGCTGG + Intronic
1084996105 11:72980166-72980188 CTTGCTAAGCATAAAAGAGAAGG + Intronic
1085149727 11:74240460-74240482 CATGAACAGCAGACTAGGGATGG + Intronic
1085160328 11:74336983-74337005 CATGATAAACAGAGGAGTGATGG + Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1086631840 11:89028958-89028980 CATGGGAAGGAGAACAGGGAGGG - Intronic
1086872850 11:92060251-92060273 CGTGAGATGCAGCAAAGGGAAGG - Intergenic
1086932706 11:92709770-92709792 GCTGATATGCAGAACAGGGAAGG + Intronic
1087237014 11:95731386-95731408 CATGTTAAGCAGGAAAGGAGAGG - Intergenic
1087539217 11:99493657-99493679 AATGTTAAGAAGAAAAGGCAGGG + Intronic
1087707064 11:101505426-101505448 AATGACAAGCTGAAAATGGAAGG + Intronic
1088278215 11:108111451-108111473 CATGTTTAGCAGAGAAGGGAAGG - Intergenic
1088549424 11:110996200-110996222 GATGATAATCAGAAAAGGCCGGG + Intergenic
1089245859 11:117119201-117119223 GGTGATGAGCTGAAAAGGGAAGG + Intergenic
1089790628 11:120940935-120940957 CATGGAATGCAGAAAAGGGCAGG - Intronic
1091450778 12:570776-570798 GAGGATCAGCAGAAAAGGGGCGG - Intronic
1092931862 12:13323190-13323212 TATGATGAGCAGAAGAGGAATGG + Intergenic
1092991940 12:13911621-13911643 CATGATTCGTGGAAAAGGGAGGG - Intronic
1093184110 12:16000097-16000119 CATGCTGAGCAGGGAAGGGAAGG + Intronic
1093421738 12:18981887-18981909 AATGACAAACAGAAGAGGGAGGG + Intergenic
1095257197 12:40052393-40052415 CATGCTAAGCAAAAAAAGGGTGG + Intronic
1095972526 12:47912418-47912440 CATGATAAGTAGGAAAAGGGAGG + Intronic
1097894664 12:64812829-64812851 TATGAAGAGCAGAAAAGGGTTGG + Intronic
1100615293 12:96226821-96226843 GAAGATAAGAAGAAAAGAGATGG + Intronic
1101568823 12:105934644-105934666 CTTGAGAAGCAGGCAAGGGAGGG + Intergenic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1103277007 12:119720551-119720573 CATGAAAAGGTGAAAATGGAAGG - Exonic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104107368 12:125675712-125675734 CATAGGAAACAGAAAAGGGAAGG + Intergenic
1104463649 12:128973648-128973670 GGTGAGAGGCAGAAAAGGGAGGG - Intronic
1105947226 13:25200536-25200558 TATGAAAAGCAGAATAGGGCCGG - Intergenic
1107197172 13:37666730-37666752 CATGCGAAGATGAAAAGGGAAGG - Intronic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1109081953 13:57914847-57914869 CATGATAAGTAGAAATTTGAGGG + Intergenic
1109214438 13:59572029-59572051 TATTAAAAGCAAAAAAGGGAGGG + Intergenic
1109591505 13:64490023-64490045 TTTGATAAACAGAAAAGTGAGGG + Intergenic
1109711669 13:66168639-66168661 CTTTAGAAGCAGAAAAGGAAAGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1113030712 13:105990814-105990836 AAAGATAAACAGGAAAGGGAAGG - Intergenic
1113159279 13:107361650-107361672 CAAGATAAGGTGAAAAGTGAAGG + Intronic
1113748764 13:112764473-112764495 GATGATGAGCAGAACAGGGCAGG + Intronic
1114175248 14:20312735-20312757 CCTAACAAGCAGAAAAGAGATGG + Intronic
1115148814 14:30259346-30259368 GATGACAAGCAAAAAAGGTATGG + Intergenic
1115219333 14:31044232-31044254 CATAATAAGTAGAAAAGGAAGGG - Intronic
1115484457 14:33896897-33896919 CATGGGAAACAGGAAAGGGAAGG + Intergenic
1115506007 14:34094796-34094818 CATAAGAAACAGAAAAGGGCTGG + Intronic
1115544854 14:34456529-34456551 CATCATCAGCAGCAAAGAGATGG + Intronic
1115924435 14:38414790-38414812 AATGATAAGCAGAAAAAAGCAGG + Intergenic
1116443467 14:44980971-44980993 CAGGATTAGGAAAAAAGGGATGG + Intronic
1116490246 14:45496388-45496410 CCTGATGTGCAGGAAAGGGAGGG + Intergenic
1116787581 14:49304383-49304405 CAGGCTAAGCAGAAAAGGAGAGG + Intergenic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1120378027 14:83734011-83734033 CATGAAAAACTGAAAAGGTAAGG + Intergenic
1120433126 14:84444342-84444364 CCAGAAAAGCAAAAAAGGGAGGG - Intergenic
1120713412 14:87816126-87816148 CATGGGAAGCAGAAGAGGTAGGG - Intergenic
1120984464 14:90321868-90321890 CATGAAGAACAGAAAAGGCAGGG + Intronic
1121070809 14:91018914-91018936 CATGTTAAGAGGAAAAGAGAGGG - Intronic
1123694307 15:22866110-22866132 CTTGATAGGGAGAAAAGGTATGG - Intronic
1123999432 15:25742473-25742495 GATGAAAGGCAGAAAAGGCAAGG - Intronic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1125812233 15:42551267-42551289 CCTGATAAGAAGAAAAAGGCTGG - Intronic
1126669473 15:51103036-51103058 CCAGAAAAGAAGAAAAGGGAAGG - Intronic
1126688278 15:51267091-51267113 CATGAAAAGCAGGAAACGGGAGG - Intronic
1127118646 15:55752045-55752067 CATGCAAAGCAGAAAAATGATGG - Intergenic
1129148483 15:73671296-73671318 CTTCTTAAGAAGAAAAGGGAGGG - Intergenic
1129363199 15:75037443-75037465 GAGGATAAGAAGAAATGGGAGGG + Intronic
1131797445 15:96034189-96034211 CATGTTAACCATGAAAGGGAGGG + Intergenic
1133101736 16:3484227-3484249 AATAATAAGCAGGAAAGAGAGGG + Intronic
1133342902 16:5048567-5048589 CAAGATAAGCAAAAAACTGAGGG + Intronic
1136410224 16:30072201-30072223 CAAAATAAGCAGAAAAGGGAAGG - Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1138686310 16:58728981-58729003 ATTGAAAAGCAGAAAAGGGCCGG - Intronic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1142888773 17:2929647-2929669 CATGAAAGGCAGTGAAGGGAAGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145754072 17:27377494-27377516 CATCACAAGAAGAAAAAGGATGG + Intergenic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1146502113 17:33373040-33373062 TAGGATAAGCAGAAAGGGAATGG + Intronic
1146712271 17:35052591-35052613 GAAGAAAAGCAAAAAAGGGAGGG + Intronic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147814599 17:43199874-43199896 CATAAAAAGGAAAAAAGGGATGG + Intronic
1149350575 17:55782835-55782857 CATGCTATGCAGACAAGGTAAGG - Intronic
1151049454 17:70960403-70960425 CTTGATAAGGGGAGAAGGGATGG + Intergenic
1153545599 18:6202134-6202156 AGTGATGTGCAGAAAAGGGAAGG - Intronic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1153937121 18:9937913-9937935 CAGGATAAGCAGAAATGAAAAGG + Intronic
1153974836 18:10259868-10259890 AAAGACAAGCAGAAAAGGAAAGG - Intergenic
1154208543 18:12358925-12358947 CATGCTCAGCAGAAAAGAGCTGG + Exonic
1154508148 18:15062634-15062656 CAAGATATAGAGAAAAGGGAGGG + Intergenic
1155881732 18:31157658-31157680 CATGAGAAGCAGAAAAAGGGAGG + Intronic
1156017850 18:32566505-32566527 TATGATGAGCAGAAAAATGATGG + Intergenic
1156336620 18:36178395-36178417 CATTACAAGAGGAAAAGGGAAGG + Intronic
1156706782 18:39892349-39892371 GATGCTAAGCAGAAAAGGGAAGG + Intergenic
1157181632 18:45503473-45503495 AATGGCAAACAGAAAAGGGAAGG - Intronic
1157313325 18:46568666-46568688 CATGAAAAGCAGTAATGGGGAGG - Intronic
1157405859 18:47422342-47422364 CAAGTGAAGGAGAAAAGGGAAGG - Intergenic
1157889148 18:51398051-51398073 CTTAACAAGCAGAAAAGTGAAGG - Intergenic
1158727821 18:59990538-59990560 CAAGACAAGCAGAGAAGGGTGGG - Intergenic
1158742805 18:60163425-60163447 TGTGATAAGAAGAAAATGGAAGG + Intergenic
1159367203 18:67483739-67483761 CTTGAGAAGCTGAAAAAGGAAGG - Intergenic
1159379181 18:67634174-67634196 CAGCAAAAGAAGAAAAGGGAAGG + Intergenic
1159506544 18:69344768-69344790 AGTGATAAACAGAAAAGGAAAGG + Intergenic
1159891757 18:73959474-73959496 CATGAGCAGCAGAAAATCGAGGG + Intergenic
1159944016 18:74430196-74430218 CAGGAGAAGCAGAGAAGGGTGGG + Intergenic
1160375254 18:78406499-78406521 CATGATGAGCAGGCAAGGAAAGG + Intergenic
1161186149 19:2922187-2922209 AATGATCAGGACAAAAGGGATGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166537820 19:43586112-43586134 CATCAAAAGCAGAACAGGCATGG - Exonic
1166774544 19:45304409-45304431 CATGAGCAGGAGAAAAGGCATGG + Intronic
1168562906 19:57398213-57398235 GATGGTAAGCATACAAGGGAGGG - Intronic
1202664781 1_KI270708v1_random:108123-108145 CATGAAAAGCTGAAAAGGTCAGG - Intergenic
925156244 2:1650841-1650863 CTTGACAAGCAGAAATGGGCTGG - Intronic
925946644 2:8870236-8870258 GGTGATAAGGAGAAAAGGGCAGG + Intronic
927265018 2:21136773-21136795 CACAATAAGTGGAAAAGGGAAGG - Intronic
927487631 2:23499589-23499611 GAGGCTAAGGAGAAAAGGGATGG + Intronic
927837057 2:26407559-26407581 CATAATAATTAGTAAAGGGACGG - Intronic
928460293 2:31466101-31466123 GATGAAAAGCAGAAAAGTGGTGG + Intergenic
929593841 2:43163335-43163357 CAGGAGAGGCAGAGAAGGGAGGG - Intergenic
930428338 2:51240447-51240469 CATCATAAACAGAAAAGAAAGGG - Intergenic
931512045 2:63009415-63009437 CATGCTGAGAAGAAAAAGGAAGG + Intronic
931630715 2:64296140-64296162 CATGAAGAGCAGAATAGGGAAGG - Intergenic
933158437 2:78999058-78999080 CATTAAAATCAGAAAAGGGCTGG + Intergenic
933272230 2:80245579-80245601 AATGACAAGCAGGAATGGGATGG - Intronic
933321337 2:80779310-80779332 CAAGAAAAGAAGAAAAGGGGTGG - Intergenic
933494242 2:83028515-83028537 CATGATCAGCATAAAAGTGGTGG - Intergenic
935748263 2:106208555-106208577 CATGGTAACAAAAAAAGGGAAGG + Intergenic
936602588 2:113912560-113912582 CATGATGAACAGAAATGAGAAGG - Intronic
937838918 2:126505391-126505413 CATCATTAGCAGAAAAGGAGCGG + Intergenic
938091720 2:128438801-128438823 CAAGATCAACAGAAGAGGGATGG + Intergenic
938463104 2:131510557-131510579 CATGACACGCAGAGCAGGGAGGG - Intergenic
938709829 2:133966656-133966678 TATGATAAGGAGAAGAGAGAGGG - Intergenic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
939460402 2:142490896-142490918 CTTGATGTGCAGAGAAGGGAGGG + Intergenic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
939895527 2:147786524-147786546 CCTGATAAGCAGAGAAGGATGGG - Intergenic
939967711 2:148626673-148626695 CATGCTAAGAAGCAAAGGAAAGG + Intergenic
940683894 2:156821956-156821978 CATGCTAAGCAGTAAAAGAAAGG - Intergenic
940766064 2:157790764-157790786 CAAGATGAGAAGTAAAGGGATGG - Intronic
940903137 2:159145165-159145187 TTTGGTAAGCAGAAAAAGGAAGG + Intronic
942251822 2:174053829-174053851 GAAGAAAAGGAGAAAAGGGAAGG + Intergenic
942255876 2:174097440-174097462 CAAGAAAAACAGAAAAGGAAAGG + Intronic
942501811 2:176599069-176599091 CATCATAATGACAAAAGGGATGG - Intergenic
942635305 2:177997785-177997807 CAGAAGAAGCAGAAAATGGAGGG - Intronic
942849984 2:180472854-180472876 CATGAAAAAAAGAAAAAGGAAGG - Intergenic
943699844 2:190977808-190977830 CAGGATAAGAGGAAAAGGGCAGG + Intronic
945147764 2:206756489-206756511 CATGAGAAGGAGAAAAGCAAAGG + Intronic
945188793 2:207166077-207166099 CAGGAGGAGGAGAAAAGGGAGGG - Intronic
945840014 2:214876402-214876424 TATGATAAGGAGAAAAGAAAGGG + Intergenic
946094165 2:217258091-217258113 CTTTATAGGCAGAAAAGGGCTGG - Intergenic
947483072 2:230521141-230521163 CATGACAAGCAGAGAAAGGATGG - Intronic
947838254 2:233190329-233190351 CTTGAGAAGCAGAGAAGGGCAGG - Intronic
948058239 2:235025413-235025435 AATGATAAGCAGCCGAGGGAAGG + Intronic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169300329 20:4436625-4436647 TAGGGTAAGCAGAAAAGGGGAGG - Intergenic
1170334484 20:15253145-15253167 CAAAATAGGCAGGAAAGGGAAGG + Intronic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1172927270 20:38549779-38549801 TATGAAAAGAAAAAAAGGGAAGG - Intronic
1173253886 20:41379427-41379449 AATGAAAATCAGAAAAGGCAAGG - Intergenic
1174657921 20:52187140-52187162 CATGGTAGGAAGAAAAGGCATGG + Intronic
1175060143 20:56234445-56234467 TATGATGAGAAGAAAATGGAAGG - Intergenic
1178389901 21:32189634-32189656 CATGATAAAACGTAAAGGGATGG - Intergenic
1180331510 22:11485043-11485065 CATGAAAAGCTGAAAAGGTCAGG - Intergenic
1181479771 22:23191262-23191284 CAAGATAAACAGAAAAGAGATGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184435400 22:44471302-44471324 CATGCTAACAAGAAAAGGAAGGG - Intergenic
1184649376 22:45912671-45912693 CATGATAAGTACAGAGGGGATGG + Intergenic
949273290 3:2246705-2246727 CATGAAAAGGAGAGAGGGGATGG + Intronic
949399859 3:3654777-3654799 CTTGAGAAGCAGAAAACGAATGG + Intergenic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
951118781 3:18898372-18898394 CATGATAAGGAGATAAGAGAGGG - Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
953162891 3:40437865-40437887 CATGAGAAGCTGAAAAAGCAAGG + Intergenic
953384171 3:42496578-42496600 CAAGTTATGTAGAAAAGGGAGGG - Intronic
955076785 3:55621364-55621386 CATGAAAAGCAAAAGAGGGTGGG + Intronic
955823827 3:62924146-62924168 CATTAGAAGTAGAAAAGGGTTGG - Intergenic
956118933 3:65946368-65946390 GATGAAATGCAGAAAAGGCAGGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956390937 3:68771998-68772020 CAAAATAAGTATAAAAGGGAGGG + Intronic
956594975 3:70957676-70957698 CATGGTATGCAGAAATGTGATGG - Intronic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957091155 3:75731615-75731637 CATGAAAAGCTGAAAAGGTCAGG + Intronic
958616577 3:96500771-96500793 CATGATGAACTGAAAATGGAAGG + Intergenic
959160403 3:102716940-102716962 GATGACAAGGAGAAAAGGGAGGG + Intergenic
960119446 3:113932379-113932401 CAGGATAGGTAGAAAAGGTATGG + Intronic
960400390 3:117190715-117190737 GATGATAAGTAGGAAAGAGATGG + Intergenic
960446373 3:117753874-117753896 TGTGATGAGCAGAAAAGGGTGGG + Intergenic
960690816 3:120344616-120344638 CATCATGAACAGAAAAAGGAAGG + Intronic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961138157 3:124531701-124531723 CAAGAACAGCACAAAAGGGATGG + Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
962091861 3:132252630-132252652 CATTTTAACCAGGAAAGGGATGG - Intronic
962537545 3:136343707-136343729 CATGATAAGCCACAAACGGAGGG - Intronic
963617019 3:147553298-147553320 CATGATAAACACAGAAGAGAAGG - Intergenic
963938350 3:151076908-151076930 AATGAAAAGGAGATAAGGGATGG - Intergenic
965123303 3:164591661-164591683 CATAATAAGAAGGAAAGTGATGG + Intergenic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
965977159 3:174640215-174640237 CATGAGAAGCAGTTAAGGGCAGG - Intronic
967203142 3:187093106-187093128 CATCAAAAGCACAAAAGGTAGGG - Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG + Intergenic
971265632 4:25094130-25094152 GATGAGAAGCAGAGGAGGGAAGG - Intergenic
971899559 4:32641354-32641376 CTTAATAACTAGAAAAGGGATGG + Intergenic
972391680 4:38619503-38619525 CCTCAGAACCAGAAAAGGGAAGG - Intergenic
972859885 4:43154563-43154585 CATGATGAACAGAAAACTGAAGG - Intergenic
974752660 4:66160928-66160950 CATGCTAAGCAGGAAAGATAAGG - Intergenic
976145367 4:82037683-82037705 CATTTTAAGGAGAGAAGGGATGG + Intronic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
981122151 4:141064714-141064736 GGTGATGGGCAGAAAAGGGAGGG + Intronic
982128136 4:152202075-152202097 CATCATATGCAAACAAGGGAAGG - Intergenic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
983496900 4:168452248-168452270 GATGATAAGCCAAAAAGGTATGG - Intronic
983742601 4:171153804-171153826 CAAAATGATCAGAAAAGGGAAGG - Intergenic
984069138 4:175090928-175090950 AATAATAAGCACAAAAGGTAAGG + Intergenic
984247065 4:177287412-177287434 CAAGATGAGCAGATAAGGCAGGG - Intergenic
986415768 5:7526297-7526319 AAGGACAAGAAGAAAAGGGAAGG + Intronic
986506112 5:8453624-8453646 CATGAAAAGAATAAAAGTGAGGG + Intergenic
986999467 5:13645119-13645141 CATGTTAAGTAGAGAAAGGAGGG + Intergenic
987187531 5:15440496-15440518 CATGATTGGCAAAGAAGGGAGGG - Intergenic
987851182 5:23356954-23356976 CAGGATGAGGAGAAAAGTGAAGG + Intergenic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990631784 5:57678384-57678406 CTTGATAATAAGAAAAGGAATGG + Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991585643 5:68199016-68199038 CATGTTAAGAAGAAAAGTGATGG - Intergenic
991724167 5:69519468-69519490 CAAGATATCCAGAAAAAGGAAGG - Intronic
993977347 5:94498604-94498626 CTTCTTATGCAGAAAAGGGAAGG - Intronic
994365237 5:98908241-98908263 CATAATAAAAAGAAAAGAGAAGG - Intronic
994778596 5:104065186-104065208 CTTGATGTGTAGAAAAGGGAGGG + Intergenic
994944196 5:106364060-106364082 CATGATGAGCTGAAAATAGAAGG - Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
999828042 5:155292830-155292852 CATGTTGAGCAGAAATGGCAAGG + Intergenic
999954636 5:156687147-156687169 CAGATTAAGCAGAAAAGGCAGGG + Intronic
1000456336 5:161454127-161454149 CATGATGAGAAGAAAAGGAGAGG + Intronic
1004864814 6:19842627-19842649 CTTGCAAAGCAGAAACGGGAAGG - Intergenic
1006185475 6:32179253-32179275 CTTGAAAGGCAGAAAAGAGAGGG + Intronic
1006238302 6:32655345-32655367 CATGATAATCAGGAAGGGCAAGG + Intergenic
1006928075 6:37669832-37669854 CATGAAAAGCAAACAAGAGATGG + Intronic
1007021705 6:38527835-38527857 CATGAAAATCAGAAATAGGAAGG + Intronic
1007343274 6:41207628-41207650 CATTATCAGGAGAAAAGGAAGGG + Intergenic
1007623916 6:43231678-43231700 TATGAGAAGGAGAAAAGGCAAGG - Intergenic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1008372030 6:50743726-50743748 GATAATATGAAGAAAAGGGAGGG - Intronic
1008479294 6:51968383-51968405 CAGGAAAAGAAGAAAAGGGAGGG - Intronic
1008815789 6:55564001-55564023 AATGCTAAGCAGAAATGGAAAGG + Intronic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010344651 6:74797777-74797799 CAAGGTAAGCATAAAAGGGCAGG + Intergenic
1010579307 6:77574515-77574537 CATAACAAGCAGAAAAGAAAAGG - Intergenic
1011259513 6:85456623-85456645 GAAGATGAGCAGAAAAGGGTGGG + Intronic
1012335716 6:98054401-98054423 CAGGATTAGCAGAACAGGGTGGG - Intergenic
1013075594 6:106768296-106768318 CAAGAAGAGCAGAAGAGGGAAGG + Intergenic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1015064832 6:129011809-129011831 CATTTTAAGTGGAAAAGGGATGG + Intronic
1015093367 6:129385294-129385316 GAAGAAAAGAAGAAAAGGGAAGG + Intronic
1015192368 6:130485439-130485461 GATGGTAAGCAGAAGAGGCAGGG + Intergenic
1015268725 6:131317010-131317032 TATGAAAAGAAGAAAAGAGAGGG + Intergenic
1015637017 6:135287114-135287136 GAAGAAAAACAGAAAAGGGAAGG + Intronic
1016705606 6:147103237-147103259 CATGAAAAGTAGAAAATGTAAGG - Intergenic
1016840821 6:148523329-148523351 CATTATAAGCTGGAAAGAGAAGG + Intronic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1018296025 6:162344876-162344898 CGTGATAGGCAGAAGAGGTAAGG + Intronic
1018576378 6:165264306-165264328 CATGAGAAGCAGGAAAGGAAGGG - Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020718985 7:11717456-11717478 CATGGAAAGCAGAAAATGGAGGG - Intronic
1021065546 7:16167993-16168015 CATAAAAAGAAGAAAGGGGAAGG - Intronic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022801966 7:33785423-33785445 GATGATGTGTAGAAAAGGGAAGG + Intergenic
1023003780 7:35840252-35840274 AAAGAAAAGAAGAAAAGGGAAGG - Intronic
1023677006 7:42641244-42641266 TATGATAAGGAGATAAGAGAGGG + Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1027158731 7:75786991-75787013 CTTGATGTGCAGGAAAGGGATGG - Intronic
1027457246 7:78408070-78408092 GATGATAAGCATAGAAGGGAGGG - Intronic
1027597687 7:80195809-80195831 CCTGAAAAACAAAAAAGGGAAGG - Intronic
1027874536 7:83751569-83751591 CCTGCTAAGCAGGAAAGAGAAGG - Intergenic
1028937678 7:96484613-96484635 CATTATGAACAGAAAAGGCATGG + Intronic
1028941295 7:96525213-96525235 GATGAGAATAAGAAAAGGGAGGG - Intronic
1030347856 7:108454928-108454950 CCTGATGCGAAGAAAAGGGAAGG + Intronic
1030667218 7:112292585-112292607 CAAGAAATGCAGAAAAGGGAAGG - Intronic
1031375640 7:121022091-121022113 AATGATAAGCATAAAAGACATGG - Intronic
1031507736 7:122607284-122607306 CAAAATAACCAGAAAAGGTATGG + Intronic
1032598324 7:133265476-133265498 CTTGATGAGTAGAAAAGGCAGGG + Intronic
1032656243 7:133933577-133933599 CATAATAAGCAGAAGATGAAGGG + Intronic
1033140540 7:138822454-138822476 CAGGATAGGCACAAAAGGGTGGG + Intronic
1034894515 7:154867589-154867611 CATAATAACCAGAAAAGGAAAGG - Intronic
1037819056 8:22127030-22127052 CATGATGAGCAGAAAGGTAAGGG - Exonic
1038336892 8:26652845-26652867 CATGTGAAGCAGGAAAGAGATGG + Intronic
1038341681 8:26691420-26691442 CATGATAAGCCAAAAAGGGTGGG + Intergenic
1038458058 8:27691397-27691419 CATGACAAGCACAAAAAGAAGGG - Intergenic
1038931423 8:32197796-32197818 CAAAATATGCAGAAGAGGGAGGG - Intronic
1038966858 8:32583297-32583319 CATCTTGAGCAGAAAAAGGAGGG - Intronic
1042081517 8:65059582-65059604 AATCCTAGGCAGAAAAGGGAGGG + Intergenic
1044206639 8:89498554-89498576 TAAGAGAAACAGAAAAGGGAGGG - Intergenic
1044461434 8:92449277-92449299 TATGAGAAGCAGGAAAGGTATGG - Intergenic
1045271496 8:100665712-100665734 CATGAGAAAAAGAAAAGGTAGGG + Intergenic
1045539226 8:103066512-103066534 GAAGATAGACAGAAAAGGGAGGG + Intronic
1045799840 8:106089466-106089488 CATTCTCAGCAGGAAAGGGAGGG - Intergenic
1046029346 8:108765018-108765040 CTTGATAGGCTGAAAACGGAAGG - Intronic
1046891755 8:119429979-119430001 AGTGGTAAGCAGAAAAGGAAAGG - Intergenic
1047624884 8:126646561-126646583 CATGTTAAGTAGAAGATGGACGG + Intergenic
1047920752 8:129632128-129632150 CATTATAAGAAGAAAAGGCCGGG + Intergenic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1048591795 8:135827156-135827178 GATGCTAAAGAGAAAAGGGAAGG - Intergenic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1050763675 9:9106014-9106036 CATCATAATTAGAAAAGGGGGGG + Intronic
1051010915 9:12413029-12413051 CAAGATAACAGGAAAAGGGAAGG + Intergenic
1051555553 9:18378666-18378688 CATGAGAGCCAGAAAAGAGAAGG - Intergenic
1052023837 9:23553790-23553812 GATGATAAGCGGAAAGGAGAGGG - Intergenic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1055113740 9:72585512-72585534 CAATACAAGAAGAAAAGGGAAGG + Intronic
1055129740 9:72761477-72761499 GATAATCAGCAGAAAAGGGGAGG - Intronic
1055568848 9:77595952-77595974 CAGGATAAGGAGAATAGAGATGG + Intronic
1055856521 9:80694521-80694543 AATGATGAGCAGGAAAGAGAAGG + Intergenic
1056376829 9:86022808-86022830 CAGGACAAGCAGGAAAGGAAGGG - Intergenic
1057037103 9:91818924-91818946 CATGACCTGCAGAAGAGGGAGGG - Intronic
1057243723 9:93435756-93435778 CATGATAAAGAGAACAGGAAAGG - Intergenic
1058024440 9:100125551-100125573 AATGACAGGCAGAGAAGGGAAGG - Intronic
1058812426 9:108653824-108653846 CATGTTATGCAGAAAAGAGAAGG + Intergenic
1059592710 9:115679357-115679379 CATGATAAGGAGCTAAGGCAGGG - Intergenic
1059709129 9:116851239-116851261 CATGATTAGCATAAAAGACAGGG + Intronic
1060145737 9:121250840-121250862 CATGATAAGCAAAAAAGGGAAGG - Intronic
1060239452 9:121890322-121890344 CATGATGAGCTGACAAGTGATGG - Intronic
1062136038 9:134929015-134929037 CACGATAAGCAGAAAATGAGGGG - Intergenic
1185502864 X:611876-611898 CATGATAAGCAGATAAAACAAGG - Intergenic
1185504545 X:621562-621584 CATGATAAGCACGGAAGGGTGGG - Intergenic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1187095712 X:16145862-16145884 CATAATAAGCAGAAAATGAGAGG + Intronic
1187112928 X:16320023-16320045 CATGACAAAAAGAAAAGGCATGG + Intergenic
1188923361 X:36007780-36007802 CTTGATAATCAGAGAAGGCAGGG + Intergenic
1188924009 X:36016800-36016822 GAGGATACGGAGAAAAGGGAAGG - Intergenic
1189300125 X:39946513-39946535 CATGAGAAGGAGGAAAGGGAAGG - Intergenic
1189518647 X:41742342-41742364 CAAGTGAAGCAGAGAAGGGAAGG - Intronic
1190121725 X:47665843-47665865 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190125626 X:47702875-47702897 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190721372 X:53151577-53151599 CATGATAAGGGGATAAGAGAGGG + Intergenic
1191006591 X:55716695-55716717 TTTGATAAGAAAAAAAGGGAAGG - Intergenic
1192896561 X:75448479-75448501 CATGATAAGGGGATAAGAGAAGG - Intronic
1193935980 X:87622349-87622371 CATGATGTGCAGAATAGGCAAGG + Exonic
1194938991 X:99986744-99986766 TATGAAGAGCAGAAAAGGGATGG + Intergenic
1195835070 X:109104809-109104831 CATAAAAAGCTGAAAATGGAAGG - Intergenic
1196000440 X:110778613-110778635 CAAGTTATGGAGAAAAGGGAAGG + Intronic
1196983468 X:121241566-121241588 AATGATAAGGAGACAAGGAAAGG - Intergenic
1197283785 X:124569682-124569704 CATGAAAATTAGAAAAGAGATGG + Intronic
1197701011 X:129599692-129599714 CATGACAAGCAGACAAGCCAAGG - Intergenic
1197758181 X:130010635-130010657 CAAGAGAAGCAAAAAAGGCAAGG - Intronic
1198118180 X:133564753-133564775 CATGAAAAGGTGAACAGGGATGG + Intronic
1199406978 X:147473740-147473762 CATGAAAAGCACAGGAGGGATGG - Intergenic
1201248709 Y:12033493-12033515 ACTGATAAGAAGAAAAGAGAGGG - Intergenic
1201790774 Y:17838593-17838615 CATAATATGTTGAAAAGGGATGG + Intergenic
1201810780 Y:18067396-18067418 CATAATATGTTGAAAAGGGATGG - Intergenic