ID: 1054928670

View in Genome Browser
Species Human (GRCh38)
Location 9:70614136-70614158
Sequence AAGGATACCCAGCCTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054928670_1054928675 26 Left 1054928670 9:70614136-70614158 CCATGAACAGGCTGGGTATCCTT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1054928675 9:70614185-70614207 GCTTCCTCATTTGTAAAATGGGG No data
1054928670_1054928673 24 Left 1054928670 9:70614136-70614158 CCATGAACAGGCTGGGTATCCTT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1054928673 9:70614183-70614205 CAGCTTCCTCATTTGTAAAATGG 0: 9
1: 212
2: 1747
3: 6365
4: 13439
1054928670_1054928674 25 Left 1054928670 9:70614136-70614158 CCATGAACAGGCTGGGTATCCTT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1054928674 9:70614184-70614206 AGCTTCCTCATTTGTAAAATGGG 0: 9
1: 190
2: 1554
3: 5585
4: 12277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054928670 Original CRISPR AAGGATACCCAGCCTGTTCA TGG (reversed) Intronic
900856793 1:5192027-5192049 AGGGATGCCCGGCCTGTGCATGG + Intergenic
901369794 1:8787253-8787275 ATGGCTCCCTAGCCTGTTCAAGG + Intronic
902462410 1:16588112-16588134 CAGGACACCAAGCCTGTTCCTGG - Intronic
902534067 1:17108938-17108960 AAGGCCACCCAGCATGTTGATGG - Intronic
902624189 1:17667204-17667226 AAGGAGGCCCAGCCTGCTCTGGG + Intronic
902844311 1:19097629-19097651 AAGGTTACACAGCTTGTTCAAGG + Intronic
903325773 1:22567743-22567765 AAGGACACCCAGCCTCCCCACGG + Intronic
904699297 1:32348786-32348808 AAAGACACCCAGGCAGTTCATGG - Intergenic
904803164 1:33111157-33111179 AAGGTTACCCAGCAAGTACATGG - Intronic
905846770 1:41241097-41241119 AAGGAAACCCATTCTGTTCCTGG - Intronic
906613932 1:47222343-47222365 GAGGTTACCCAGCTTGATCAAGG - Intronic
907058498 1:51396290-51396312 AAGGATGCTCAGCCTGTACTTGG - Intronic
909364602 1:74804508-74804530 AAGAATACCCAGACATTTCAAGG - Intergenic
913603061 1:120440405-120440427 CAGGACACCAAGCCTGTTCCTGG + Intergenic
913603809 1:120446757-120446779 CAGGACACCAAGCCTGTTCCTGG + Intergenic
913640674 1:120809474-120809496 CAGGACACCAAGCCTGTTCCTGG + Intronic
913974774 1:143446491-143446513 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
914069165 1:144272107-144272129 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
914109990 1:144694247-144694269 ATGGAGACCCAGCCTGTGCTGGG + Intergenic
914211851 1:145587150-145587172 CAGGACACCAAGCCTGTTCCTGG - Intergenic
914277804 1:146140871-146140893 CAGGACACCAAGCCTGTTCCTGG - Intronic
914364241 1:146964020-146964042 CAGGACACCAAGCCTGTTCCTGG + Intronic
914365010 1:146970310-146970332 CAGGACACCAAGCCTGTTCCTGG + Intronic
914365761 1:146976592-146976614 CAGGACACCAAGCCTGTTCCTGG + Intronic
914487441 1:148123116-148123138 CAGGACACCAAGCCTGTTCCTGG - Intronic
914538849 1:148591819-148591841 CAGGACACCAAGCCTGTTCCTGG - Intronic
914587785 1:149078270-149078292 CAGGACACCAAGCCTGTTCCTGG - Intronic
915887665 1:159740616-159740638 ATGGATACCCAGACTGCTCATGG - Intergenic
920929864 1:210377102-210377124 AAAGATCCCCAGCCTGTTGGGGG - Intronic
923739225 1:236640491-236640513 TACCATACCCAGCCTCTTCAGGG - Intergenic
924506829 1:244693781-244693803 AAGGTTACCTAGCCTGTTGGTGG + Intronic
1063383203 10:5599759-5599781 AAGGTCAAACAGCCTGTTCAAGG - Intergenic
1067666835 10:48286241-48286263 AAGGGGACCCAGCCTGATGAAGG - Intergenic
1067780418 10:49199124-49199146 AAGAAAACTCAGCCTGTCCAAGG + Intergenic
1073448194 10:103593330-103593352 CAGGCTACCCAGCCTCTGCATGG + Intergenic
1073630701 10:105145785-105145807 AAGGTGACCCAGACAGTTCAAGG + Intronic
1074198463 10:111209402-111209424 CAAGGTACCCTGCCTGTTCATGG - Intergenic
1076156298 10:128208231-128208253 ATGGATACCCAAGGTGTTCAGGG - Intergenic
1077081073 11:724994-725016 CAGGATCCCCAGCCTGTTGGAGG + Intronic
1079668562 11:23136550-23136572 AAGGAAACCTTGCCTGCTCACGG - Intergenic
1089366219 11:117922692-117922714 AAGGCTTCTCAGCCTGCTCAGGG + Intronic
1092022963 12:5217274-5217296 CTGGTTCCCCAGCCTGTTCATGG + Intergenic
1095120807 12:38416453-38416475 AAGTATTCCCAGCATGTTTAAGG + Intergenic
1097708964 12:62897656-62897678 AAGGACACCCAGCCTTGGCATGG + Intronic
1100795152 12:98174435-98174457 AAGGTCACCCAGCCCGTTAAGGG + Intergenic
1101395482 12:104343241-104343263 ATGGTAACCCAGCCTGGTCATGG + Intronic
1102835254 12:116051514-116051536 AAGGATATTCAGCCTGTACTTGG - Intronic
1103578130 12:121894016-121894038 AAGGATGCCCAGCTTGTACATGG + Intronic
1105389344 13:19959694-19959716 AAGGACACCGAGCCTGCTCCCGG - Intronic
1105894989 13:24709914-24709936 AAGCTTTCCCAGGCTGTTCAGGG - Intronic
1107382830 13:39875669-39875691 CAGAAAACCCACCCTGTTCAGGG - Intergenic
1107769913 13:43778792-43778814 GAGGATTCCCAGCCCTTTCAGGG + Intronic
1110416641 13:75260753-75260775 AAGGAAGCCCAGCCTGGGCATGG + Intergenic
1111014520 13:82361064-82361086 AAATATACCCTGCCTGTTGATGG + Intergenic
1113334946 13:109368686-109368708 AAGGAGACCCAGCGTCTTCTTGG - Intergenic
1117645459 14:57846900-57846922 ATGGATACCCAGCTTGTTCTAGG + Intronic
1118246410 14:64115200-64115222 AAGGATTTCCAGGCTGCTCAAGG + Intronic
1118873124 14:69759963-69759985 GACTATACCCAGCCTGATCAAGG + Intronic
1119203280 14:72774997-72775019 AAGATGACCCAGGCTGTTCAGGG + Intronic
1121889771 14:97578642-97578664 ATGGCTCCCCAACCTGTTCAAGG - Intergenic
1124636666 15:31369588-31369610 AAGTTTACCCAGCCTTTTGATGG + Intronic
1124822933 15:33065970-33065992 AAGGTTACCCAGCCAGTAAATGG + Intronic
1125673691 15:41491300-41491322 AAGGACACACAGCCAGTTGATGG - Intergenic
1127468046 15:59264233-59264255 AAGGATACTCAGCCTGTACAGGG + Intronic
1133622475 16:7539659-7539681 AAGGATACCGAGACTGTTTCTGG + Intronic
1136294666 16:29294852-29294874 AAGGATCCCCTCCCTCTTCAGGG - Intergenic
1137774180 16:51041774-51041796 AAGGGGGCCCAGCCTGTTCCCGG + Intergenic
1138509696 16:57501246-57501268 AATGAGACCCAGTCTGTACAAGG + Intergenic
1138770235 16:59654062-59654084 AAGGAGAGCCAGCATGTTTAGGG + Intergenic
1140884004 16:79226959-79226981 AAGGTTCCCCATCCTGTTCCTGG - Intergenic
1141461792 16:84182194-84182216 AAGGATACGCAGCCTGTCCTGGG + Exonic
1142100570 16:88268896-88268918 AAGGATCCCCTCCCTCTTCAGGG - Intergenic
1143951810 17:10638491-10638513 AAGGGAAACCAGCCTGTTCTTGG - Intronic
1144842285 17:18194667-18194689 AAGGGTTCCTGGCCTGTTCAGGG + Intronic
1147675113 17:42199935-42199957 AAGGAGAGCCTGCCTGCTCAGGG - Exonic
1148605923 17:48928702-48928724 GAAGAGACCCAGCCTCTTCAAGG - Exonic
1148773439 17:50079792-50079814 AAGGAACCCCAGCCTGTTGGGGG + Intronic
1149604532 17:57915641-57915663 AAGGATACCCAGGCCGGACAGGG - Intronic
1151520029 17:74621512-74621534 AAGGAAATCCAGCATGTTCCTGG + Intronic
1152203549 17:78961208-78961230 GAGGAAGCCCAGCCTTTTCAGGG + Intergenic
1153452997 18:5250320-5250342 AAGTATATGCAGCCTGTTGAAGG - Intergenic
1153708236 18:7769310-7769332 AAAGTTACACAGCCTGTCCAAGG - Intronic
1157780238 18:50431952-50431974 AGGGATCCCCAACCTGTCCATGG + Intergenic
1158939377 18:62392992-62393014 AAGGATACCCAGGGTGCTAAAGG + Intergenic
1161824740 19:6555018-6555040 AAGTAAACCCAGCCTGGGCAAGG + Intergenic
1162392604 19:10398483-10398505 CGGGATACCCAGCCGGTACATGG - Intronic
927734583 2:25507878-25507900 AAGCATACCTAGCATGTTTAAGG - Intronic
928208546 2:29305610-29305632 AAGTATACCCAGCTTGATCTTGG + Intronic
928254787 2:29712761-29712783 AAGGAGACCTATCCAGTTCAGGG - Intronic
928317267 2:30255905-30255927 AAGGTCACACAGCTTGTTCATGG - Intronic
929658626 2:43759535-43759557 AAGGAGACCCACCCTGCCCAGGG + Intronic
930858537 2:56044713-56044735 TAGGAAACCCATCGTGTTCAGGG + Intergenic
931938396 2:67223984-67224006 AAGTCTACCCACCCAGTTCATGG + Intergenic
934179472 2:89607459-89607481 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
934289764 2:91681727-91681749 ATGGAGACCCAGCCTGTGCTGGG - Intergenic
934477112 2:94601169-94601191 AAGGTCACACAGCCTGTACATGG - Intronic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
939442500 2:142267519-142267541 AAGGAAACCCAGGATGTTTAAGG + Intergenic
943452632 2:188064345-188064367 AAGAATACCTAGTGTGTTCAAGG - Intergenic
943976761 2:194489866-194489888 CAGGAAACAGAGCCTGTTCATGG + Intergenic
1170878990 20:20278060-20278082 AATTAAACCCTGCCTGTTCATGG + Intronic
1171994340 20:31720711-31720733 AAAGTAACCCAGCCTGTCCAAGG + Intronic
1172007332 20:31826510-31826532 AAGGCTAGCAGGCCTGTTCAAGG + Intronic
1173090063 20:39962041-39962063 AAGGCTCCCCATCCTGTTCCCGG + Intergenic
1173912126 20:46678174-46678196 ACTGAGACCCAGCCTATTCAAGG - Intronic
1174239300 20:49120039-49120061 AAGGATCTCCAGCATGTTCTCGG + Exonic
1177474837 21:21606742-21606764 AGGGATACTCAGCCTGTAAAAGG - Intergenic
1178223306 21:30685584-30685606 AATGATACAAAGCCTGTGCAGGG - Intergenic
1178464662 21:32835984-32836006 AAGGAAACTGAGCTTGTTCAAGG - Intergenic
949395988 3:3615276-3615298 GAGGCCACCCAGCCTGTGCAAGG - Intergenic
949469640 3:4381003-4381025 AGGGGTAGCCAGCCTGCTCACGG + Intronic
949584509 3:5424752-5424774 AAGGATTCGCAGACTGTTCAGGG + Intergenic
950202740 3:11056579-11056601 GAGGAAAGGCAGCCTGTTCAGGG - Intergenic
953904721 3:46862800-46862822 AACGAGACCCAGCCTGGACAGGG + Intronic
955517954 3:59746809-59746831 AAGGATTGCCAGCCTCATCAAGG + Intergenic
958815315 3:98907851-98907873 AAGGTTACCCTGCCTGTCCAAGG - Intergenic
959585153 3:108018899-108018921 AAGGAAAGGGAGCCTGTTCAAGG - Intergenic
960037186 3:113113812-113113834 GAGGATCCCCTACCTGTTCAAGG + Intergenic
960610531 3:119551225-119551247 GAGGTTACCCAGCTTGCTCAAGG - Intronic
960818492 3:121700373-121700395 AAGGTTACGCAGCTAGTTCAGGG + Intronic
961641687 3:128368758-128368780 AAGGATGCCCAGCATGTTGCAGG + Intronic
964198422 3:154090296-154090318 AATGTGACCCAGCTTGTTCAAGG - Intergenic
967091560 3:186138855-186138877 ATAGATTCCCAGCCTGTGCACGG - Intronic
967234414 3:187370328-187370350 AAGGATACGCAACCTGCTTAAGG - Intronic
971212269 4:24630067-24630089 GAGTATGCCCAGCATGTTCAAGG - Intergenic
973716213 4:53679140-53679162 ATGGATACCCATCCTTTTCCAGG - Intronic
974929958 4:68350246-68350268 TAGGTTACCCAGGTTGTTCATGG + Intergenic
975382795 4:73721746-73721768 GAGGATATGCAGCTTGTTCAAGG - Intergenic
980275893 4:130650333-130650355 CAGCATACCCAGCCTATTGATGG - Intergenic
980565677 4:134537304-134537326 AAGAATACCCAGCCTGGGCGGGG + Intergenic
982165933 4:152613745-152613767 AATGATCCCCAGCCTGTGGAGGG - Intergenic
982496659 4:156103146-156103168 AGGGATACCCAGCATATTTAGGG - Intergenic
982596875 4:157396643-157396665 AAGGATACCTAGCTTGTTACCGG - Intergenic
985925840 5:3017654-3017676 AAGTACACCCAGCTTGATCAAGG + Intergenic
993312677 5:86355876-86355898 AAGGATGCCCATCCTGACCATGG - Intergenic
997719335 5:136065349-136065371 TAGGATACCCAGCATGAGCAAGG - Intergenic
998134467 5:139667503-139667525 AAGGTCACACAGCCTGTTGAGGG + Intronic
1005198849 6:23319983-23320005 CAGGAAACCCTGCCTCTTCAGGG + Intergenic
1006936907 6:37724973-37724995 AAGGATTCCCAGCCTGCTGGGGG + Intergenic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1007645678 6:43378794-43378816 AAGGATAACCAGCCTGGGCCAGG - Intergenic
1010717207 6:79243510-79243532 CAGGAAATCCAGCCTATTCAAGG + Intergenic
1012432216 6:99175976-99175998 AAGGACACTAATCCTGTTCATGG + Intergenic
1013900386 6:115148719-115148741 AACCCTACCCATCCTGTTCAAGG + Intergenic
1017233193 6:152094311-152094333 TAGGAGACCCAGAGTGTTCATGG - Intronic
1024090122 7:45930829-45930851 AAAGATACACACCATGTTCATGG - Intergenic
1026775327 7:73227504-73227526 GAGGAGACCCAGAGTGTTCAGGG + Intergenic
1027016184 7:74780875-74780897 GAGGAGACCCAGAGTGTTCAGGG + Intronic
1027071844 7:75165062-75165084 GAGGAGACCCAGAGTGTTCAGGG - Intergenic
1028092306 7:86718450-86718472 AAGGATACTCTGCCTTTTCTTGG + Intronic
1029450147 7:100636975-100636997 CATGGTGCCCAGCCTGTTCAGGG - Intronic
1037375382 8:18221767-18221789 AATGATAAACAGCTTGTTCATGG - Intronic
1038964075 8:32551801-32551823 AAGGAGACCCAGGCTGTTACAGG - Intronic
1039524329 8:38200295-38200317 AAGGGTACCCAGGCTGGGCACGG - Intronic
1039608945 8:38903900-38903922 AAGGCAACCCAAACTGTTCATGG - Intronic
1043887672 8:85620820-85620842 CAGAATACCCATCCTATTCAAGG + Intergenic
1044163300 8:88948212-88948234 AATCATACCCAGCTTGTTCTAGG - Intergenic
1045552611 8:103186072-103186094 TGGGATGCCCAGCCTCTTCAGGG + Intronic
1046985365 8:120381928-120381950 GAGGATACCCAGGCTGTTCCAGG + Intronic
1049556414 8:143284536-143284558 AGGGATACTCAGGCTGTACAAGG + Intergenic
1051046652 9:12883852-12883874 CAGGACACCCAGCCTGCACAGGG + Intergenic
1053334593 9:37254867-37254889 AGGGATACTCAACCTGTTCTTGG + Intronic
1053414531 9:37938767-37938789 AGGGAACCCCAGCCTGTTGACGG + Intronic
1053680960 9:40484924-40484946 AAGGTCACACAGCCTGTACATGG + Intergenic
1053930949 9:43113238-43113260 AAGGTCACACAGCCTGTACATGG + Intergenic
1054282753 9:63140011-63140033 AAGGTCACACAGCCTGTACATGG - Intergenic
1054294043 9:63320439-63320461 AAGGTCACACAGCCTGTACATGG + Intergenic
1054392067 9:64624928-64624950 AAGGTCACACAGCCTGTACATGG + Intergenic
1054426715 9:65130139-65130161 AAGGTCACACAGCCTGTACATGG + Intergenic
1054503662 9:65891400-65891422 AAGGTCACACAGCCTGTACATGG - Intronic
1054928670 9:70614136-70614158 AAGGATACCCAGCCTGTTCATGG - Intronic
1055356838 9:75446451-75446473 AAGGCTACCCACCCTTATCAGGG + Intergenic
1055663903 9:78534276-78534298 AAGGTTACTAATCCTGTTCATGG - Intergenic
1056263766 9:84875645-84875667 AAGGATACCTTGGCTGTGCAAGG + Intronic
1058307068 9:103457280-103457302 AAGTATGCCCAGTGTGTTCAAGG + Intergenic
1058719015 9:107746776-107746798 AAGGATACCCAGGCTGGGCGCGG - Intergenic
1062351733 9:136142917-136142939 AAGCATACCCCACCTGCTCAGGG + Intergenic
1186090901 X:6047985-6048007 AAGGAAAAACAGCCTGGTCATGG + Intronic
1187583780 X:20637796-20637818 AAGGATTCCCAGTGTGTTCAAGG - Intergenic
1187718940 X:22131877-22131899 GAGGAGGCCCTGCCTGTTCATGG - Intronic
1193046245 X:77057965-77057987 AAGGGGAGCCAGCATGTTCAGGG - Intergenic
1197173635 X:123461947-123461969 AAGGAAACCCAGGCTTTACAAGG + Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198720509 X:139613627-139613649 AAGGACACACAGCCAGTACATGG + Intronic
1200158359 X:153990511-153990533 AAGGATTCCCTTCCTTTTCATGG - Intergenic
1200179398 X:154141146-154141168 AAGGCCACCCAGCCAGCTCATGG + Intergenic
1202016312 Y:20410461-20410483 AAGGAGGCCTAGACTGTTCAGGG - Intergenic