ID: 1054931111

View in Genome Browser
Species Human (GRCh38)
Location 9:70636309-70636331
Sequence CTTGCAGCCCATACAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054931110_1054931111 12 Left 1054931110 9:70636274-70636296 CCATTAAAAATGTAAAAAAAAAA 0: 5
1: 17
2: 158
3: 2071
4: 11721
Right 1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054931111 Original CRISPR CTTGCAGCCCATACAGAAAC AGG Intronic
No off target data available for this crispr