ID: 1054936952

View in Genome Browser
Species Human (GRCh38)
Location 9:70698250-70698272
Sequence ATGGAGAATCGGCTTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054936952_1054936956 11 Left 1054936952 9:70698250-70698272 CCTTCTTCAAGCCGATTCTCCAT 0: 1
1: 0
2: 2
3: 10
4: 141
Right 1054936956 9:70698284-70698306 GTTTTGGAGCAAGCAGCCTCTGG No data
1054936952_1054936954 -5 Left 1054936952 9:70698250-70698272 CCTTCTTCAAGCCGATTCTCCAT 0: 1
1: 0
2: 2
3: 10
4: 141
Right 1054936954 9:70698268-70698290 TCCATGTAACAGCAGAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054936952 Original CRISPR ATGGAGAATCGGCTTGAAGA AGG (reversed) Intronic
903288469 1:22291913-22291935 ATGGAGAATGGGCTGGAAAGGGG + Intergenic
903548653 1:24142724-24142746 ATGGAGAATTGGCCTGGAGGAGG - Intronic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
909567909 1:77076333-77076355 TTGGAGAATAGGCTTCAACATGG + Intergenic
909635534 1:77813072-77813094 CGGGAGAATCGGCTTGAACCTGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911740230 1:101378970-101378992 ATAGAGAATGGGCTTCTAGAGGG - Intergenic
914355229 1:146879082-146879104 ACGGAGAATGGGCTTGAAGAGGG - Intergenic
915211592 1:154313579-154313601 CAGGAGAATCGGCTTGAACCTGG - Intergenic
915715078 1:157937816-157937838 ATGAAGAATGAGCTTGGAGAGGG + Intergenic
915793330 1:158699780-158699802 ATAGATAATGGGGTTGAAGAAGG + Exonic
917520688 1:175746194-175746216 ATGTAGAAACGGCTAAAAGAAGG + Intergenic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
920508174 1:206531646-206531668 AAGGAGAATCCCCTTGAAAAGGG + Intronic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923191062 1:231621261-231621283 ATCCAGAATCGGCTCCAAGAGGG + Intronic
1062779696 10:190848-190870 AAGGAAAATGGGCTTGAATAAGG - Intronic
1064753860 10:18557584-18557606 ATGGAGAATGGAATGGAAGATGG + Intronic
1068966457 10:62916786-62916808 ATGGAGTATCTGCTTAATGAAGG - Intronic
1069924032 10:71835900-71835922 ATGTAGAATTGGCTTACAGAGGG - Intronic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1073544351 10:104336354-104336376 ATGGAGAATCTGCTTGGAAGGGG - Intronic
1074112026 10:110429524-110429546 ATGGGGCATTGGCTTTAAGAAGG - Intergenic
1079017126 11:16878687-16878709 AGGGAGAATCGCCTTGAACCTGG - Intronic
1079055001 11:17198200-17198222 TAGGAGAATCGGCTTGAACCTGG - Intronic
1081498949 11:43646050-43646072 CAGGAGAATCGGCTTGAACCTGG + Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083533347 11:63445797-63445819 CTGGAGGATCTGCTTCAAGATGG + Intergenic
1083669093 11:64290624-64290646 ATAGAGAATCAGCTTGAAGCTGG + Intergenic
1084050057 11:66593505-66593527 ATGAAGAAGGTGCTTGAAGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085230358 11:74962692-74962714 ATGGAGAACCATCTGGAAGAAGG - Intronic
1085252274 11:75151685-75151707 GAGGGGAAACGGCTTGAAGAGGG - Intronic
1086109806 11:83187589-83187611 GTGGAGAAATGGGTTGAAGATGG + Intergenic
1087342281 11:96921864-96921886 TAGGAGAATCGGCTTGAATCCGG + Intergenic
1088516933 11:110646894-110646916 ATGGTGAATAGACTGGAAGAAGG + Intronic
1088826687 11:113501200-113501222 ATGGTGAATCTGCTTGGAGAGGG + Intergenic
1090752690 11:129761150-129761172 ATGGAGTATTGGCTGGAAGTAGG - Intergenic
1091659632 12:2373736-2373758 AAGGAAAATGGGCTTGAAGAGGG - Intronic
1094097663 12:26725891-26725913 ATGGAGAGTTGGCTGGAGGACGG - Intronic
1099009554 12:77275934-77275956 ATGAAGAATGGATTTGAAGAAGG + Intergenic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1100396199 12:94188414-94188436 CAGGAGAATCGGCTTGAACCTGG - Intronic
1103099155 12:118157256-118157278 ATGGAGAATGGCCTGGGAGATGG - Intronic
1103752794 12:123177440-123177462 CAGGAGAATCGGCTTGAACCCGG + Intronic
1104388879 12:128374825-128374847 AAGGAGAATCGGTTTGAACCTGG + Intronic
1106116762 13:26824434-26824456 ACAGAGAATTGGCTGGAAGAAGG + Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1112907634 13:104444169-104444191 GTGGAGAATAGGCTGGAAAAAGG + Intergenic
1114845996 14:26322688-26322710 ATGGAGAAACGACTTGACCAAGG - Intergenic
1116769063 14:49106270-49106292 ATGGAGAATTGACTTAGAGAAGG - Intergenic
1116869926 14:50061085-50061107 AGGGAGAAGAGGCTGGAAGAGGG + Intergenic
1116926966 14:50649162-50649184 TTTGAGAAGAGGCTTGAAGAGGG - Intronic
1122161820 14:99790703-99790725 ATGGAGAAGCGGCTTTCAAAGGG - Intronic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1129346539 15:74924085-74924107 CAGGAGAATCGGCTTGAACCCGG + Intronic
1130010696 15:80151456-80151478 AGGGAGAAGAGGCTGGAAGATGG - Intergenic
1131301818 15:91206371-91206393 ATGGAGAACCTGCTGGAAGGGGG - Intronic
1133521811 16:6565558-6565580 CAGGAGAATCGGCTTGAATCTGG - Intronic
1136564092 16:31059568-31059590 CAGGAGAATCGGCTTGAACCCGG - Intergenic
1137893561 16:52186959-52186981 CTGGAGAATCGGCTTCAGGATGG - Intergenic
1137895603 16:52208444-52208466 ATGGAGAATCCTCTTCAAAAAGG - Intergenic
1139978786 16:70836448-70836470 ACGGAGAATGGGCTTGAAGAGGG + Intronic
1146075705 17:29726470-29726492 ATGGAGAATGGATTGGAAGAGGG + Intronic
1146512862 17:33465464-33465486 CAGGAGAATCGGCTTGAACCCGG - Intronic
1150201861 17:63365454-63365476 GTGGAGAATGGACTCGAAGAGGG - Intronic
1151257023 17:72885809-72885831 ATGGAGAGTCGGCATTAAGTAGG - Intronic
1153689348 18:7575946-7575968 GTGGAGAATCTGATTGAAGATGG + Intronic
1154244139 18:12680501-12680523 CAGGAGAATCGGCTTGAACCTGG + Intronic
1159039243 18:63307753-63307775 ATAGATAAGCTGCTTGAAGAGGG + Intronic
1166125514 19:40713453-40713475 CAGGAGAATCGGCTTGAACCCGG + Intronic
1167666485 19:50825468-50825490 GAGGAGAAGCGGCTTGAAGCAGG - Intronic
1168542538 19:57225152-57225174 ATGGAAAATAGGCTTGTAGGTGG - Intergenic
928332627 2:30369287-30369309 ATGGGGCACCGGCTGGAAGAGGG + Intergenic
928493792 2:31811225-31811247 ATGGGGAATAGTCTGGAAGATGG - Intergenic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
929770490 2:44887742-44887764 ATAGAGAATCATCTTGAGGAAGG - Intergenic
932124737 2:69133461-69133483 TTGGAGACTCACCTTGAAGAGGG + Intronic
935827475 2:106965728-106965750 ATGGAGATTCTGCTGGAGGAGGG + Intergenic
936377795 2:111957228-111957250 ATGGAGAATAGACCTTAAGAAGG - Intronic
938289660 2:130142552-130142574 ATGGAGAATGGGGTTGAGGGAGG - Intronic
939811812 2:146842025-146842047 ATGGAGAATCAACTCTAAGAAGG - Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940240826 2:151561530-151561552 ATGGAGAATAGGCATGGAAAAGG - Intronic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
942562444 2:177235021-177235043 CAGGAGAATCGGCTTGAACCTGG + Intronic
944959913 2:204860439-204860461 ATGGAGAAACTGCTGGCAGATGG + Intronic
945459728 2:210091784-210091806 ATGGAAAATTGGGATGAAGAAGG - Intronic
946912765 2:224482920-224482942 ATGAAGAGTGGGCATGAAGATGG + Intronic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1170029824 20:11933075-11933097 AAGGAGGATTGGCTGGAAGAGGG + Intergenic
1173036099 20:39412452-39412474 ATAGAGGATAGGTTTGAAGAAGG - Intergenic
1175067923 20:56305825-56305847 ATGGGAAATGGGCTTGAGGAGGG + Intergenic
1176093951 20:63331048-63331070 ATGGCGAATCGGGTTCAGGAGGG + Intronic
1177113598 21:17058712-17058734 ATGGAGAAAAGCCTAGAAGAAGG + Intergenic
1178428770 21:32500903-32500925 AGGGAGAATTTGCTTGAACACGG - Intronic
1179678454 21:43000908-43000930 TTGGAGAATGGACTGGAAGAGGG + Intronic
1181553537 22:23654472-23654494 CAGGAGAATCGGCTTGAACCTGG - Intergenic
949414046 3:3798089-3798111 ATGGATAATCTGCATGAAAAGGG + Intronic
954288801 3:49638144-49638166 ATGGAGAGCCAGCTTGGAGAGGG + Intronic
955342865 3:58138891-58138913 ATGGAGAATGGCCATGAAGATGG - Intronic
960481008 3:118190242-118190264 ATGGAGGAGGGGCTTCAAGATGG + Intergenic
961177381 3:124846839-124846861 CAGGAGAATCGGCTTGAACCCGG + Intronic
961500309 3:127327662-127327684 ATGGCGAATGGGATTAAAGAAGG + Intergenic
962878483 3:139554131-139554153 CTGCAGAATCGGCCTGAAGGTGG + Intergenic
963539905 3:146572061-146572083 ATGGAGAATGGACTGTAAGATGG + Intergenic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966629101 3:182052052-182052074 ATGGAGAATCGGCTTTCCCAAGG + Intergenic
967069186 3:185947123-185947145 ATGGAGAATGGGTTGGAAGGAGG + Intergenic
967101568 3:186220442-186220464 AAGGAGTATGGGCTGGAAGACGG - Intronic
974078949 4:57193580-57193602 GTGGAGAGTGGGGTTGAAGAGGG - Intergenic
980487168 4:133473733-133473755 ATGGAGAATGAACTTGAGGAGGG - Intergenic
980649351 4:135689947-135689969 ATGGAGAATAGGAGTGAAAAAGG + Intergenic
981243295 4:142504921-142504943 ATGGAGATTTGTGTTGAAGATGG + Intronic
981483030 4:145257052-145257074 ATGGAGAATCTGTTTGTAGTTGG + Intergenic
982049315 4:151484604-151484626 GTGGAAAATGGGTTTGAAGATGG + Intronic
985179149 4:187237637-187237659 CAGGAGAATCGGCTTGAATCCGG - Intergenic
988580665 5:32466024-32466046 CAGGAGAATCGGCTTGAACCTGG + Intergenic
990001580 5:50899389-50899411 GTGGAGGATGGGCTTGGAGAGGG + Intergenic
990827652 5:59920301-59920323 TTGGAGAATGGGCTTGGAAATGG - Intronic
991214697 5:64148869-64148891 ATGGTGAAAGGGCTTGGAGAAGG - Intergenic
991502608 5:67292004-67292026 ATGTAGAATGGGCATTAAGATGG - Intergenic
992343945 5:75857048-75857070 CAGGAGAATCGGCTTGAATCCGG - Intergenic
992876460 5:81060374-81060396 CTGGAGAAACGACTTGAAGCAGG - Intronic
993434960 5:87881618-87881640 ATGGAGCCTGGACTTGAAGAAGG + Intergenic
997992142 5:138553344-138553366 CAGGAGAATCGGCTTGAACCTGG + Intergenic
1000518769 5:162273935-162273957 GTGAAGAAATGGCTTGAAGAAGG - Intergenic
1001525497 5:172425780-172425802 GTGTGGAAACGGCTTGAAGAGGG + Intronic
1002331769 5:178447772-178447794 ATGGAGAATCTGTTGGAAGGAGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1010085957 6:71918313-71918335 ATGGAGAATCATTTTTAAGAAGG + Intronic
1011015293 6:82747924-82747946 ATGGAGAATTTGTTTGGAGATGG + Intergenic
1014798926 6:125756255-125756277 CTGGAGAATGGCCTTCAAGAAGG + Intronic
1026677679 7:72441683-72441705 AGGGCGAATCGTCTTGAACAAGG + Intronic
1030540324 7:110822543-110822565 ATGGATAATTGGCTTGGGGATGG - Intronic
1034163495 7:149009017-149009039 AAGGAGAATTGGCTTGAACTTGG - Intronic
1034960955 7:155364091-155364113 ACAGAGAATCGGTTTGAAGCGGG + Intronic
1035971502 8:4254333-4254355 ATGGAGAGTCTGCTTGTATAGGG + Intronic
1041970242 8:63732962-63732984 GTGAAGAATGGGTTTGAAGAAGG - Intergenic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1052275442 9:26670548-26670570 ATGAAGAATGTGCTTGGAGAGGG + Intergenic
1052841902 9:33298812-33298834 GTGGAGAATAGGCTCTAAGAAGG + Intronic
1052911904 9:33890472-33890494 CAGGAGAATCGGCTTGAACCCGG + Intronic
1054936711 9:70696071-70696093 TTGGACAATCAGCTTGAAGAAGG + Intronic
1054936952 9:70698250-70698272 ATGGAGAATCGGCTTGAAGAAGG - Intronic
1059071242 9:111138662-111138684 AAGGAAAATAGGCTTGAATATGG - Intergenic
1059708774 9:116848191-116848213 ATGGAAAACAGGCTTGGAGAGGG + Intronic
1192065318 X:67879224-67879246 ATGGAGACATGGCATGAAGACGG + Intergenic
1194766896 X:97852167-97852189 ATGGAGAATCTGCTTAAATATGG + Intergenic
1195070358 X:101273249-101273271 CTGGAGAATGGGTTGGAAGAAGG - Intronic
1197662994 X:129193957-129193979 ATGGAGAGTAGGTGTGAAGAAGG + Intergenic
1200835462 Y:7727410-7727432 AGGGAGAATGGGCTCGAAGGAGG + Intergenic
1201580135 Y:15502573-15502595 ATGGAGAATGGGTTTGGAGGAGG + Intergenic
1202081926 Y:21092526-21092548 ATTGAGAATCTGCTTGTAGAGGG + Intergenic