ID: 1054942844

View in Genome Browser
Species Human (GRCh38)
Location 9:70762816-70762838
Sequence GACAAATATTCAGAAGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054942844_1054942851 24 Left 1054942844 9:70762816-70762838 CCTAGTTCTTCTGAATATTTGTC 0: 1
1: 0
2: 1
3: 24
4: 325
Right 1054942851 9:70762863-70762885 TTGCCTCTGTTTACACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054942844 Original CRISPR GACAAATATTCAGAAGAACT AGG (reversed) Intronic
905466688 1:38159659-38159681 GCCATATATTCACATGAACTTGG - Intergenic
906553013 1:46682085-46682107 AACAAATATTCAGGAGTACCAGG + Intronic
908010109 1:59767576-59767598 GTCAAATATTCAGAAGTACTGGG - Intronic
908065592 1:60400618-60400640 AACAAATCTTCAGAAGCAGTTGG - Intergenic
908568019 1:65378680-65378702 GATTTATATTCAGAAGATCTGGG + Intronic
908918998 1:69167682-69167704 GAAAAAAATTCAGAGTAACTGGG + Intergenic
909931064 1:81501286-81501308 GACAAATCTTCAGATGTCCTTGG - Intronic
910079035 1:83317256-83317278 GGCACATATTCAGCAGAACATGG + Intergenic
910454609 1:87384030-87384052 CACATATATGCAGAAGACCTGGG - Intergenic
911889003 1:103342764-103342786 TATAGATATCCAGAAGAACTAGG + Intergenic
912087187 1:106023182-106023204 GATAAATACTCAGTAGAAATTGG + Intergenic
913457717 1:119050349-119050371 GAAAAAGATTAAGGAGAACTGGG - Intronic
916844744 1:168638271-168638293 GACAAATTCTCAAGAGAACTTGG - Intergenic
917506547 1:175632574-175632596 TACAAATATACAGAAGTACTTGG - Intronic
917560438 1:176147511-176147533 CACAAATATCCAGAAGTATTTGG + Intronic
917845202 1:179014772-179014794 GAGAAAGAATCAGTAGAACTTGG - Intergenic
918139402 1:181707761-181707783 GACAAATATCCAGGCTAACTAGG - Intronic
918937405 1:190940583-190940605 TACAAATATTCAGAAGGATGTGG + Intergenic
921030968 1:211334929-211334951 GACAAAGAACCAGAAGACCTGGG + Intronic
921590632 1:216999015-216999037 CACAAATAATCACAAGAAATAGG - Intronic
923458418 1:234186505-234186527 GGCAAGAATTCAGAAGGACTGGG - Intronic
1063558074 10:7099670-7099692 CAGAAATATTGAGAAGAACCAGG - Intergenic
1063886233 10:10582094-10582116 GACAAATTTTCACAGGAACAAGG - Intergenic
1063895068 10:10671287-10671309 GACAATTATTTAGAAGGATTTGG - Intergenic
1064520466 10:16195685-16195707 GACAAATATCCAGAAACACAAGG + Intergenic
1064713772 10:18154175-18154197 GTAAAATATTCAGAAACACTAGG + Intronic
1065110278 10:22434298-22434320 GAAAAATATTAAGAATATCTTGG - Intronic
1065264202 10:23957893-23957915 AACAAATCTTCAGAAGAAGGTGG + Intronic
1065699641 10:28412237-28412259 GCCAAAGATTCTGAAGAAGTTGG - Intergenic
1066584967 10:36922851-36922873 CACAAAGATGCAGAAGAACATGG + Intergenic
1068087309 10:52390599-52390621 GACAAATATCCACAGGAACTTGG + Intergenic
1068421892 10:56805028-56805050 GACAAATACTAGGAAGAACATGG - Intergenic
1068440304 10:57046103-57046125 TACAAATATTTAGAAGATTTGGG - Intergenic
1069395107 10:67978965-67978987 TCCAGATATTCAGAAGGACTTGG - Intronic
1069400258 10:68036731-68036753 GAGAAATGTTGAGAAGAACAAGG - Intronic
1070430633 10:76334270-76334292 TAAAAAGAGTCAGAAGAACTGGG - Intronic
1071223876 10:83502579-83502601 GACTAATATTAATAAGAATTTGG + Intergenic
1071752299 10:88494115-88494137 GACAGATATTGAAAAGAACAAGG + Intronic
1071830143 10:89363475-89363497 GACTAATATTAAAAAGAGCTGGG + Intronic
1071935393 10:90525380-90525402 TCCAAATATTCAGAGGAACTTGG + Intergenic
1072285237 10:93908237-93908259 GACAAAGATTAAGAAGCTCTTGG - Intronic
1073802926 10:107063321-107063343 GAAAAAGCTTCAGAAGAAATGGG + Intronic
1074728314 10:116338635-116338657 AACCAATATTAAGAAGAGCTAGG - Intronic
1075641239 10:124066023-124066045 GACAAAAAGACAGAAGAATTCGG - Intronic
1078648597 11:13166222-13166244 GGCAGATTTTCAGAAGAAGTTGG - Intergenic
1079152730 11:17915472-17915494 GACCAAGAGTCAGAAGAACTAGG - Intronic
1079406266 11:20149021-20149043 GCCAAATATACAGAAGTACCTGG + Intergenic
1080971798 11:37286506-37286528 GACAAATACTCAGATGGCCTTGG + Intergenic
1081002352 11:37691006-37691028 TAGAAATATTCAGAAGATATGGG - Intergenic
1081117452 11:39221454-39221476 AACAAATATCCAGAATAAATTGG - Intergenic
1082226170 11:49710309-49710331 GACAAAAATTCAGAAAAAAAAGG + Intergenic
1082642552 11:55682318-55682340 GACACATTTTCAGTAGAACCTGG - Intergenic
1083943319 11:65910386-65910408 GAAAAATATTCATAAAAAGTGGG + Intergenic
1083988325 11:66231428-66231450 GAGAAGAAGTCAGAAGAACTGGG + Intronic
1084266886 11:68009747-68009769 GAGAAATAGCCAGAAGACCTTGG - Intronic
1085457838 11:76675308-76675330 GCCAAAGCTTGAGAAGAACTGGG - Intergenic
1085903204 11:80727301-80727323 CACAAAGATGCAGAAGAACATGG - Intergenic
1086622916 11:88909443-88909465 GACAAAAATTCAGAAAAAAAAGG - Intronic
1086649972 11:89276425-89276447 GAGAAAGAAGCAGAAGAACTGGG + Intronic
1086762792 11:90654215-90654237 TACAAATATTCAGAAGTAATAGG - Intergenic
1086877519 11:92114002-92114024 GAAAAATTTTCTGAAGAATTAGG + Intergenic
1087688912 11:101297347-101297369 GACAAATACTCAGGAGTTCTAGG - Intergenic
1088835657 11:113576194-113576216 CACAAATATTTAAAAGTACTGGG - Intergenic
1089905358 11:122032544-122032566 GACACAGATTCATAAGAATTTGG - Intergenic
1090540335 11:127695566-127695588 GACAAATATGCTCAAGATCTAGG + Intergenic
1091986695 12:4915330-4915352 GACAGATTTTCAGAAGAAGCTGG - Exonic
1092037240 12:5347247-5347269 GAAGAATATTCAGAAAACCTGGG + Intergenic
1093990870 12:25588819-25588841 GTCAAATACTCAGAAGAAAATGG + Intronic
1096737332 12:53665983-53666005 TTCAAATAGTCAGAAGATCTGGG + Intronic
1097419784 12:59361721-59361743 GACAACTATGCAAAAAAACTAGG + Intergenic
1097571024 12:61332630-61332652 AATAATTATTCAGGAGAACTTGG - Intergenic
1098207776 12:68131758-68131780 TCCAGATATTCAGAAGGACTTGG + Intergenic
1098304009 12:69084007-69084029 GGGGAAAATTCAGAAGAACTGGG - Intergenic
1098555531 12:71814540-71814562 GATAGATATACAGAAAAACTAGG + Intergenic
1098893879 12:76035520-76035542 GACAAACTTTCATTAGAACTGGG - Intergenic
1100071732 12:90729119-90729141 GACAAATATTCATCATTACTAGG - Intergenic
1100160463 12:91854174-91854196 TAAAAATATACAGAAGAATTGGG + Intergenic
1101212888 12:102552155-102552177 GAAAAAGATTAAGAAGAAGTAGG - Intergenic
1101322568 12:103686074-103686096 GACAAATATTTATAAGCAATAGG - Intronic
1103860959 12:124013437-124013459 GACATATATTCAGAAATAATAGG - Exonic
1105479267 13:20758460-20758482 TAAAATTATTCAGAAGAAATTGG - Intronic
1106357817 13:29000955-29000977 GACAAGTGTTCAGCGGAACTGGG - Intronic
1107223529 13:38017563-38017585 GACTAATATTCAGAATAAAAAGG - Intergenic
1109606022 13:64696987-64697009 GAAAAATATTCATAAGAAACTGG + Intergenic
1109788269 13:67211746-67211768 GATAAATATTCATAAGAAAATGG + Intronic
1110367728 13:74706597-74706619 CACAATAATTCAGATGAACTAGG + Intergenic
1111392854 13:87621549-87621571 TACAATTATTCTGAAAAACTTGG + Intergenic
1112158791 13:96847403-96847425 GACAGCTATGCAGTAGAACTAGG - Intergenic
1115566022 14:34626184-34626206 GACAAAAATAAGGAAGAACTGGG + Intronic
1116273229 14:42799259-42799281 GACAAATTGACAGAAGAAGTAGG - Intergenic
1116608373 14:47032806-47032828 TCCAAATCTTCTGAAGAACTTGG - Intronic
1116972327 14:51079400-51079422 GACAAATACTTAGTAGAACCTGG - Intronic
1117048933 14:51841342-51841364 GTCAAATATTCAGAATCACCTGG - Intronic
1117245004 14:53875946-53875968 GACAAGCATTTAGAAGAACAAGG + Intergenic
1117756017 14:58975009-58975031 GTAACATATTCAGAAGACCTGGG + Intergenic
1117805976 14:59491128-59491150 AACAAATGTTCATAAAAACTGGG + Intronic
1119668710 14:76502437-76502459 AACAAACACGCAGAAGAACTGGG - Intergenic
1120642657 14:87033663-87033685 GACTAATATTGAGATGAACCAGG - Intergenic
1121181107 14:91929741-91929763 GAAAAATAGACAGATGAACTAGG + Intronic
1124873998 15:33573625-33573647 GATAAATATTCAGAATCACCTGG + Intronic
1125056877 15:35370060-35370082 CACAAATATACAAAAGAACAAGG + Intronic
1126264360 15:46735139-46735161 GAAAAATTTTCAGAACATCTTGG - Intergenic
1126480591 15:49115087-49115109 GACAAAAGTTCTGAAGAAATTGG + Intronic
1127392485 15:58517950-58517972 GACCAAGAGTCAGAAGATCTGGG - Intronic
1128034274 15:64509756-64509778 GAAAATAATTCAGAAGAAGTTGG - Intronic
1128182074 15:65612850-65612872 GCCTGTTATTCAGAAGAACTAGG - Intronic
1128777531 15:70334674-70334696 GACAAAAATTCAAAAGAAGATGG - Intergenic
1128994479 15:72286671-72286693 GCCAAAAATGTAGAAGAACTTGG + Intronic
1130789200 15:87134050-87134072 AACAGATATTCAGGACAACTGGG - Intergenic
1131609612 15:93947437-93947459 AACAAATAATCAGAAGACATTGG + Intergenic
1133670106 16:8010260-8010282 GCCAAATATTCAGAGGAATGTGG - Intergenic
1135478835 16:22803660-22803682 GAAAAATAATCAGAAGAATCCGG - Intergenic
1135616092 16:23912390-23912412 GACCAAGATTCAGTAGAACAGGG - Intronic
1135852155 16:25973547-25973569 GGAAAATAATCACAAGAACTCGG + Intronic
1136349619 16:29698363-29698385 GATAAATAGCCAGAAGACCTTGG + Exonic
1137293923 16:47071802-47071824 GGCAAATTTTTAAAAGAACTAGG + Intergenic
1137346497 16:47666626-47666648 GACACACATTCAAATGAACTGGG - Intronic
1138947773 16:61872999-61873021 GAAAAACATTCAGAAGAGCCTGG + Intronic
1139501576 16:67370644-67370666 AAAAAAAAATCAGAAGAACTGGG + Intronic
1141238682 16:82244354-82244376 GAAAAGTATTAAGAAGATCTTGG + Intergenic
1141374743 16:83520083-83520105 GACAAGTATGTAGAACAACTAGG + Intronic
1141679502 16:85536075-85536097 GAAAGAGATTCAGAAGAACTTGG + Intergenic
1143209139 17:5170615-5170637 GTCAAGTAGTAAGAAGAACTTGG + Exonic
1144003279 17:11075219-11075241 GACAAGTATCCAGATGGACTGGG + Intergenic
1144006250 17:11102370-11102392 GAAATATATTCAAAAGAAATAGG + Intergenic
1144618622 17:16800087-16800109 GTCAAGTAGTAAGAAGAACTTGG + Intronic
1144894082 17:18515612-18515634 GTCAAGTAGTAAGAAGAACTTGG - Intergenic
1145115071 17:20201903-20201925 GAAAAAAATTCAGATGAACTGGG + Intronic
1145138150 17:20428648-20428670 GTCAAGTAGTAAGAAGAACTTGG + Intergenic
1149116479 17:53103206-53103228 GGCATATAGCCAGAAGAACTAGG - Intergenic
1150197432 17:63315012-63315034 GGCAAATAAGAAGAAGAACTGGG - Intronic
1151049529 17:70961426-70961448 GACAAAAATTCAGAAGGCATTGG + Intergenic
1154324267 18:13378848-13378870 GACAAATTAGCAGAGGAACTAGG + Intronic
1155768026 18:29660451-29660473 GACAAAGTATCAGAAGACCTTGG + Intergenic
1156025874 18:32654833-32654855 TCCAAATATTCAGAAGGACTTGG + Intergenic
1156732269 18:40208235-40208257 GACAAATAATTCGAAGAAGTGGG - Intergenic
1157247009 18:46063309-46063331 GACACATATTGAGTAAAACTTGG + Intronic
1159436715 18:68427517-68427539 TATTAATATTTAGAAGAACTAGG + Intergenic
1160177836 18:76610699-76610721 GAGAGGTATTCAGAAGAAATGGG - Intergenic
1166147520 19:40847876-40847898 TTAAAATATTCAGAAGAACTGGG + Intronic
1166151666 19:40879761-40879783 TTAAAATATTCAGAAGAACTGGG + Intronic
1166170555 19:41025261-41025283 TTAAAATATTCAGAAGAACTGGG + Intergenic
1166178510 19:41090884-41090906 TTAAAATATTCAGAAGAACTGGG - Intronic
1168654214 19:58115637-58115659 AAGAACAATTCAGAAGAACTAGG + Intronic
925436091 2:3838541-3838563 GACAACTACTCAGAAGAAAGGGG + Intronic
927087162 2:19683966-19683988 GACTAAAGGTCAGAAGAACTAGG + Intergenic
927356431 2:22178508-22178530 CACAACTACTGAGAAGAACTTGG - Intergenic
927403631 2:22742914-22742936 GAAATAAATTCAGAAGCACTGGG + Intergenic
928116664 2:28550108-28550130 GACAAACATGCAGATGAACCAGG + Intronic
928930132 2:36615756-36615778 GAAAAATATTTTGAAAAACTAGG + Intronic
929034735 2:37679831-37679853 GACAAATATCCAGAGGAGCCAGG - Intronic
929898483 2:45981978-45982000 GAAAGACAGTCAGAAGAACTGGG - Intronic
930842927 2:55867828-55867850 GTAATATGTTCAGAAGAACTGGG + Intronic
930997638 2:57740296-57740318 GTAAAATATTCAGATTAACTTGG - Intergenic
932070180 2:68612146-68612168 GAGAAATCTTCAGAAGAACATGG + Intronic
933536102 2:83576955-83576977 GAAAAATGTTCAGAAGCTCTAGG + Intergenic
935718015 2:105955436-105955458 GATAAGTATTTGGAAGAACTAGG - Intergenic
936848319 2:116865245-116865267 GAAAAGTATTCAGAAGAGTTGGG + Intergenic
939143060 2:138378715-138378737 GACAAAAATTCAGAAAACATTGG + Intergenic
939438425 2:142208935-142208957 GACAAAGATTCAAAAGAGCATGG + Intergenic
940176794 2:150886576-150886598 GGAAAATTTTCAGAAGTACTTGG + Intergenic
940249027 2:151653225-151653247 CACAAAAATTCAGAAGGTCTTGG - Intronic
940932730 2:159453779-159453801 GACATTTATTCAGAACAGCTGGG - Exonic
941259342 2:163276740-163276762 GAAAACAATTCATAAGAACTTGG + Intergenic
942877693 2:180821609-180821631 TACTAAAATACAGAAGAACTGGG - Intergenic
942940995 2:181616842-181616864 AACAAATATTCAGGAGAAATTGG + Intronic
943078616 2:183229443-183229465 AACAAAATTTCAGAAGAAGTAGG + Intergenic
944161424 2:196664576-196664598 CATAAAAATTCAAAAGAACTGGG - Intronic
944223932 2:197330728-197330750 GACAATTATGAAGAAGAACAAGG + Intergenic
944317746 2:198301515-198301537 GACAGATGTTCAGGAAAACTGGG - Intronic
945022776 2:205590767-205590789 GCCACATATTCACAAGAAGTAGG + Intronic
945199717 2:207269009-207269031 CACAAAATTTCAGAAGAACTGGG + Intergenic
945976064 2:216271774-216271796 AAGAAATATTCAGAGGAACCTGG - Intronic
946571832 2:221032896-221032918 AAGAAATATTCAGAATACCTAGG - Intergenic
946667701 2:222068022-222068044 CACAAAGTTTCAGAAGCACTGGG - Intergenic
947480568 2:230495896-230495918 GACAAATAATCAGAAGTAATGGG - Intronic
1169050067 20:2568622-2568644 GGCAAATACTCAAAAGCACTTGG - Intronic
1170420774 20:16190929-16190951 AAGAAATCTTCAGAAGAACATGG + Intergenic
1175291122 20:57876022-57876044 GAAAAATGTTCAGAGAAACTTGG - Intergenic
1175344855 20:58265559-58265581 GCCAAATACTCTGAAGAAGTAGG + Intergenic
1176676436 21:9783004-9783026 AACGAATAGTCAGAAGAAGTAGG + Intergenic
1177734374 21:25070549-25070571 GACAAATTTTCAGAGTATCTGGG - Intergenic
1178923353 21:36754857-36754879 GGAAAATATTCAAAAGAAGTAGG - Intronic
1179137069 21:38688998-38689020 TACTATTATTCAGAAAAACTGGG + Intergenic
1179519441 21:41932443-41932465 TACAGATAGTCAGAAGAACGGGG + Intronic
1180562956 22:16636130-16636152 GGCAGATATTGAGCAGAACTGGG - Intergenic
1182268831 22:29140085-29140107 GGGAAATATTCAGAACACCTGGG + Intronic
1182661408 22:31927859-31927881 GACAAGGATTCAGAAGGCCTGGG - Intergenic
1182857585 22:33531653-33531675 GACAAAGATCCTGATGAACTTGG + Intronic
1185399621 22:50609060-50609082 GACAAATATTAGGAAGGTCTGGG - Intronic
949334200 3:2955807-2955829 GACAGATATTGTGAAGAAATTGG + Intronic
949455517 3:4234127-4234149 TACAGATAGTCAAAAGAACTGGG + Intronic
951708317 3:25566059-25566081 GACCAATAGTCCCAAGAACTTGG + Intronic
952486503 3:33816903-33816925 CTCAAGTATCCAGAAGAACTGGG + Intronic
952949002 3:38503189-38503211 GCCAGATATTCAGAAGAACAAGG + Intronic
953069812 3:39507954-39507976 GACAAATATTCAGAAGGCAGGGG - Intronic
955158602 3:56442593-56442615 GACAAATGTTCAGATAAACAAGG + Intronic
956274908 3:67488492-67488514 GAAAATCATTCAGAAGAACAAGG - Intronic
958085178 3:88797433-88797455 TTCAGATATTCAAAAGAACTTGG + Intergenic
958513895 3:95087370-95087392 GACAAAGATGCAGAAAAACAGGG - Intergenic
960180319 3:114568058-114568080 GACAAACAGGCAGAAGGACTTGG - Intronic
960646636 3:119892364-119892386 GATAAATATTTAGTAAAACTAGG - Intronic
962000405 3:131289343-131289365 TACAAATATTCAGAGGTAATGGG + Intronic
962217176 3:133532714-133532736 TGCATATATTCAGAAGACCTTGG + Intergenic
963165754 3:142201661-142201683 GACAAATATAAAGTAAAACTGGG + Intronic
964530326 3:157660853-157660875 CATAAATATCCAGAACAACTGGG + Intronic
964606662 3:158567516-158567538 GACAAATTTTGAGAGAAACTTGG - Intergenic
964920220 3:161886976-161886998 GAAAAATATTCACAAGAAAGAGG + Intergenic
965260596 3:166478808-166478830 TACAGATATTCAAAAGGACTTGG - Intergenic
965962553 3:174445558-174445580 GACAGCTATACAGGAGAACTAGG + Intronic
966038655 3:175452500-175452522 GGAAAATATTCAAAAGAAATGGG + Intronic
967480772 3:189970524-189970546 GACAAAGAATTAGAAGACCTAGG + Intronic
967594721 3:191315677-191315699 GACGAATGTTCTGAAGCACTAGG - Intronic
968945447 4:3661212-3661234 GACAAGAATTCAGAGGAGCTGGG + Intergenic
969364751 4:6687760-6687782 GATAAATAGCCAGAAGACCTTGG - Intergenic
969405363 4:6987823-6987845 GAAACATATTCAAAGGAACTAGG - Intronic
970234743 4:13947006-13947028 GACAAAAATACAGAATAACATGG + Intergenic
971755552 4:30703210-30703232 GATTAATATTCATAAGATCTCGG - Intergenic
972814259 4:42626813-42626835 GAGAAATATTCATAAGAATCTGG - Intronic
973139483 4:46748500-46748522 GACAACTATTCAAAAAACCTTGG + Intronic
974059572 4:57019243-57019265 AATAAATATACAGAAGGACTAGG + Intronic
974666855 4:64972896-64972918 GACAAATATTTCGAAAACCTTGG - Intergenic
976244803 4:82996128-82996150 GAGAAAGTTTCAGAAGGACTGGG + Intronic
976526051 4:86090214-86090236 GAAAAATAAACAGAAGAATTAGG + Intronic
977141368 4:93376321-93376343 GACAAATATTAAGCTGAATTAGG + Intronic
978034962 4:103981306-103981328 GACAAAAAATCAGAAGAAATTGG + Intergenic
978557724 4:109998674-109998696 GACAAAGCTCCAGAAGATCTGGG - Intronic
978810547 4:112844702-112844724 GACAAATATTTTTAAGAACTAGG - Intronic
979551544 4:121996764-121996786 GACAAATCATCAGTAGAACAAGG - Intergenic
980193072 4:129550671-129550693 CTAAAATATTCAGAAGAGCTTGG - Intergenic
981085110 4:140675691-140675713 GATACAGATTCAGAAGATCTGGG + Intronic
981793683 4:148569890-148569912 AACTAATATTCAGCAGAGCTAGG - Intergenic
982206392 4:153000266-153000288 GACAAATTTTTAGAGGAGCTTGG - Intergenic
982483880 4:155944019-155944041 GACAAATATGTAGAAGCGCTAGG - Intronic
982686109 4:158491134-158491156 GACAAAAATCCAAAAGAAATAGG + Intronic
982858711 4:160419716-160419738 GATTAAAATTCAGAAGAACTAGG - Intergenic
982961258 4:161840351-161840373 GAGAAAAATTTAGAAGAAATTGG + Intronic
983949028 4:173618591-173618613 GACAAAGCTTCAGAAGGATTAGG - Intergenic
984002221 4:174263282-174263304 GACAAAGTTTCAGAATTACTTGG + Intronic
985873273 5:2575827-2575849 GCCAAATATTGGGAAGAACACGG - Intergenic
986156444 5:5181336-5181358 GACAAATATTTTTAAGATCTTGG - Intronic
986943108 5:12980835-12980857 TACAAATATTCACACGAAATGGG + Intergenic
987521567 5:18992231-18992253 GACTAATATTTGTAAGAACTGGG - Intergenic
988443318 5:31257044-31257066 ACCAAACATTCAAAAGAACTTGG + Intronic
989221674 5:38972614-38972636 GACAAGGATGCAGAACAACTGGG + Intronic
989364934 5:40645148-40645170 GCCACATTTTCAAAAGAACTAGG - Intergenic
992099460 5:73392877-73392899 GATAAACATTCAGAAGAATCTGG - Intergenic
993411773 5:87582809-87582831 GAAAAATATTAAGAAGGACCAGG - Intergenic
993623457 5:90193988-90194010 TCCAGATATTCAAAAGAACTTGG - Intergenic
994242265 5:97437861-97437883 GACAAAGATTGAGAAGCGCTGGG + Intergenic
994876127 5:105423099-105423121 AACAAATATTCAGATCTACTTGG - Intergenic
996759023 5:126968379-126968401 AACAAATATTGACAAGAATTTGG - Intronic
996800275 5:127395923-127395945 GACACAGAGTCAGAAGTACTGGG - Intronic
997394131 5:133543866-133543888 GAAAAATATTCAAAAAATCTAGG - Intronic
999916133 5:156263474-156263496 GACAAATATTCAGATTTACAAGG - Intronic
1000238278 5:159384062-159384084 GACTAATATTCAGAATCACAAGG + Intergenic
1000303400 5:159974914-159974936 GACAAAGAGGCAGAAGACCTGGG - Intergenic
1003217119 6:4124253-4124275 GAAAATTATTCATAAGAATTAGG + Intronic
1004098430 6:12583036-12583058 CACAAATATTCTGAAGAACCTGG - Intergenic
1005189424 6:23202859-23202881 TAAAAATATTCATAAGAGCTGGG + Intergenic
1005211769 6:23473918-23473940 AACAAATATCCACATGAACTGGG - Intergenic
1005260898 6:24058107-24058129 TGCAAATATTCAGAAGGAATGGG - Intergenic
1008145532 6:47887453-47887475 GAGAAAAATTCAGAATCACTGGG - Intronic
1008669496 6:53752952-53752974 GAGAAATATTCAGATGAGCCAGG + Intergenic
1009977207 6:70683879-70683901 GACAGATTTCCAGAAGACCTGGG - Intronic
1010843751 6:80679518-80679540 GAAAAATATTCACAGCAACTAGG - Intergenic
1010946458 6:81980120-81980142 CTCAAATATTCAGAAGAAAGGGG - Intergenic
1011730132 6:90253359-90253381 GAGAAATATTGAGGGGAACTGGG + Intronic
1011833146 6:91398197-91398219 AACAAATATGAAGAAAAACTAGG - Intergenic
1012030021 6:94047955-94047977 GACAAATATTCATAAAGAATGGG - Intergenic
1012486112 6:99724380-99724402 TCCAGATATTCAGAATAACTTGG + Intergenic
1012557429 6:100531653-100531675 GAAAAATTTTTAGAATAACTTGG + Intronic
1012761752 6:103310734-103310756 TCCAAATATTCAAAAGGACTTGG - Intergenic
1013754063 6:113440601-113440623 GAAAAATATTAACAAGAACCTGG + Intergenic
1014563418 6:122918239-122918261 GACAAACTTTCAGAGGAAATTGG + Intergenic
1014650389 6:124029459-124029481 GAAAAGTATAGAGAAGAACTGGG - Intronic
1016149104 6:140716711-140716733 AACAAAGATTCAGAAAAAATGGG - Intergenic
1017335547 6:153254986-153255008 GACAAAATTGCAGAAGAAATTGG - Intergenic
1017427320 6:154335755-154335777 GACTAATATTCAGAATAACAAGG + Intronic
1017474248 6:154772042-154772064 GACAAATATGGGGAAAAACTGGG + Intronic
1020370803 7:7430101-7430123 GTGAAATATTCATAAGAATTGGG + Intronic
1022467752 7:30662779-30662801 CACAAACATCCAGAAGAAGTTGG + Exonic
1022971197 7:35518887-35518909 GAAAAATATTCAGGAGAAAGAGG + Intergenic
1023747156 7:43332115-43332137 GAGAAATAATAAGAAGAAATTGG + Intronic
1024155139 7:46614473-46614495 GACAAGAATTAAGAAAAACTTGG + Intergenic
1024334108 7:48187775-48187797 GACAAATATTCAGAAAACAAGGG - Intronic
1027296807 7:76782530-76782552 GGCACATATTCAGCAGAACATGG + Intergenic
1028753941 7:94413336-94413358 GTCAAAAATACAGAAGCACTTGG + Intronic
1028950441 7:96629789-96629811 TCCATATATTCAGAAGGACTTGG + Intronic
1029162233 7:98560546-98560568 GAGGAATATTAAGAAGAAATGGG + Intergenic
1030660709 7:112216264-112216286 GACAAGGAATCAGAAGAACTAGG + Intronic
1031197442 7:118633850-118633872 GAAAAATATTTTGAGGAACTAGG - Intergenic
1031264195 7:119563896-119563918 AACAAAAATTCAGTTGAACTGGG - Intergenic
1031469849 7:122155989-122156011 GATAAATATTAAGCAGAACAAGG + Intergenic
1032639763 7:133752878-133752900 GTCAAAGGTTGAGAAGAACTGGG - Intronic
1034019029 7:147620167-147620189 TCCAGATATTCAGAAGGACTTGG - Intronic
1034442625 7:151094309-151094331 GACAAATTTTCAGAAGAAAATGG + Intronic
1034569648 7:151944902-151944924 GACTAAGATACAGAGGAACTTGG + Intergenic
1036512313 8:9411979-9412001 AACAAAATTTCAGACGAACTTGG - Intergenic
1036538337 8:9674995-9675017 AAAATATATTCAGAACAACTGGG - Intronic
1036947497 8:13108100-13108122 AACAAATGTTCAGAAGAAAAGGG - Intronic
1037292600 8:17367199-17367221 AAAAAATATCCAAAAGAACTGGG + Intronic
1037349345 8:17933641-17933663 GACAAATATATAAAATAACTAGG - Intronic
1037371403 8:18183484-18183506 GGCAGATATTCAGAAGAAGCCGG + Intronic
1041703413 8:60817662-60817684 GAAGATTCTTCAGAAGAACTTGG + Intronic
1043038901 8:75234086-75234108 GAAAAATACTCAGAAAAACAAGG - Intergenic
1043211007 8:77517799-77517821 GACAAAAATCCATAGGAACTGGG + Intergenic
1043570586 8:81598589-81598611 AACAAGTATTTATAAGAACTTGG + Intergenic
1043807806 8:84695046-84695068 AACAAATATCAAGAAGAATTAGG + Intronic
1043987320 8:86708882-86708904 GAAACAGATTCAGAAGAACATGG + Intronic
1044863246 8:96544029-96544051 GACATAGAGTCAGAAGACCTGGG - Intronic
1046178722 8:110614063-110614085 CACAAATATTCAAAAACACTTGG - Intergenic
1046688960 8:117261076-117261098 AACAAACATTGAGTAGAACTAGG - Intergenic
1049953553 9:670264-670286 GACATATATCCATAAGAACATGG - Intronic
1050053754 9:1630665-1630687 TACATATATTCAGAAAAGCTGGG - Intergenic
1050151068 9:2620431-2620453 GACAAATTTCCAGGAGAACCAGG + Intergenic
1051109240 9:13616583-13616605 GATATGCATTCAGAAGAACTGGG + Intergenic
1051537042 9:18171206-18171228 GACACATATAAAAAAGAACTTGG + Intergenic
1051805574 9:20989203-20989225 TACAACTCTTCAGAAAAACTGGG - Intronic
1052481332 9:29030797-29030819 GACAAATATTAAGAAAAAACAGG - Intergenic
1054942844 9:70762816-70762838 GACAAATATTCAGAAGAACTAGG - Intronic
1056457650 9:86777481-86777503 GATAAAAATTCACAAAAACTAGG - Intergenic
1057758672 9:97855508-97855530 GACAAATTTGCAAAAGAAATAGG + Exonic
1186142535 X:6591455-6591477 CACAAAGATTCAGAAGTTCTGGG + Intergenic
1186361130 X:8843041-8843063 GACATATTTTTAAAAGAACTAGG - Intergenic
1187500732 X:19836389-19836411 TACAAATATTCAAAATAACAGGG + Intronic
1188097176 X:26038353-26038375 TATAAATATTCAGAAGTCCTAGG - Intergenic
1188359637 X:29236874-29236896 GAAAAATATTAAGAAGAAGAAGG - Intronic
1189030601 X:37445623-37445645 GACAAATATCCGGAAAGACTTGG + Intronic
1189127820 X:38466627-38466649 GACCAATATTCAGTATAATTTGG + Intronic
1189277380 X:39796920-39796942 GACAAATACTGAGGAGAAATAGG + Intergenic
1191836348 X:65467831-65467853 GACTAATATTCAGAACTACAAGG - Intronic
1192127827 X:68518470-68518492 GACAAACAATCAGCAGACCTAGG - Intronic
1192680259 X:73246175-73246197 GATAAAAATTCTGAAAAACTGGG + Intergenic
1193046791 X:77062356-77062378 GACCAGAAGTCAGAAGAACTGGG + Intergenic
1193254839 X:79335722-79335744 GACTAATATTCAGAATATGTAGG - Intergenic
1193546065 X:82831313-82831335 CACAAAAGATCAGAAGAACTTGG + Intergenic
1193918498 X:87397389-87397411 GACAAAAATTAAAAAGAAATTGG + Intergenic
1194235773 X:91381556-91381578 TCCAAATATTCAAAAGTACTTGG - Intergenic
1194239818 X:91431667-91431689 GACTACTATCCAGTAGAACTTGG + Intergenic
1194564238 X:95463541-95463563 GGCAAATATTAATAAGAAATTGG + Intergenic
1195098910 X:101534240-101534262 GACAAATAAGTAGAAAAACTGGG + Intergenic
1196009790 X:110874476-110874498 GATAAATGTTCAGCAGCACTTGG + Intergenic
1196214384 X:113034214-113034236 TACAGATATTCAAAAGGACTTGG + Intergenic
1197120925 X:122891352-122891374 GATAAATATACGGAAGGACTGGG - Intergenic
1197612525 X:128655102-128655124 GAAAAGTATTCAGGAAAACTAGG + Intergenic
1198627200 X:138590265-138590287 TACAAATATTTATAAGATCTAGG + Intergenic
1199511116 X:148623845-148623867 CAGAAATTTTCAAAAGAACTGGG - Intronic
1199658889 X:150026497-150026519 CACAAATATTCAGAGGAAAGTGG + Intergenic
1200947651 Y:8862839-8862861 GACAAATAGTTAGATGACCTTGG + Intergenic
1202199119 Y:22328492-22328514 GACAAATATTAATTAGAATTTGG + Intronic