ID: 1054942848

View in Genome Browser
Species Human (GRCh38)
Location 9:70762850-70762872
Sequence ACAGAGGCAACATGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054942848_1054942851 -10 Left 1054942848 9:70762850-70762872 CCACCACACCATGTTGCCTCTGT 0: 1
1: 0
2: 1
3: 38
4: 366
Right 1054942851 9:70762863-70762885 TTGCCTCTGTTTACACCAAGTGG No data
1054942848_1054942855 21 Left 1054942848 9:70762850-70762872 CCACCACACCATGTTGCCTCTGT 0: 1
1: 0
2: 1
3: 38
4: 366
Right 1054942855 9:70762894-70762916 ACTGCCTCTCTTCATCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054942848 Original CRISPR ACAGAGGCAACATGGTGTGG TGG (reversed) Intronic
900165202 1:1241727-1241749 CCAGAGCCAAAATGGGGTGGGGG + Intergenic
901673777 1:10871054-10871076 AATGAGGAAACATGGTGGGGAGG + Intergenic
902187244 1:14734598-14734620 ACAGACTCAACCGGGTGTGGTGG - Intronic
902274581 1:15330352-15330374 CCAGAGGCCACATGTTGTGCAGG + Intronic
903076629 1:20773918-20773940 ACAGATGCAATATGGTATAGTGG + Intronic
904005086 1:27359400-27359422 TCACAGGTAACAAGGTGTGGGGG - Exonic
905457861 1:38100760-38100782 TCAGAGGCATCAGGGTTTGGTGG + Intergenic
906380004 1:45326789-45326811 TCCGAGGCGACAGGGTGTGGGGG + Intergenic
906472178 1:46140278-46140300 AGAGAGGGGACACGGTGTGGTGG - Intronic
906662266 1:47591107-47591129 ACTGAGGGAACTTGGTGTGTAGG + Intergenic
907325825 1:53638134-53638156 ACAGAGGCCACACGGTGTAAGGG + Intronic
907488666 1:54794847-54794869 ACAGAGTCAGCATGATGAGGTGG - Intronic
907536705 1:55168090-55168112 ACAGAGGAAACATGGCTTGGGGG + Intronic
907684965 1:56601450-56601472 ACAAAAGCAATGTGGTGTGGTGG - Intronic
908911905 1:69081128-69081150 ACAGTTGGAACATAGTGTGGGGG + Intergenic
910867736 1:91803450-91803472 ACAGAAGCAGCATGCTGAGGAGG + Intronic
912322366 1:108726379-108726401 CAAGACGCTACATGGTGTGGAGG + Intronic
912801266 1:112720975-112720997 ACAGAGGCAAGGTGGTGCAGTGG + Intronic
913104965 1:115605709-115605731 GTAGAGGCAACCTGGTGTGGTGG - Intergenic
913150640 1:116039183-116039205 ACAGAGGCAACATGCTCCTGAGG - Intronic
914826632 1:151142287-151142309 TTAGAGGCAGCATCGTGTGGAGG - Intronic
915312671 1:155012189-155012211 TCCGTGGCAACTTGGTGTGGTGG - Intronic
917085215 1:171298185-171298207 ACACAGACAACATGGAGTAGGGG + Intergenic
918041761 1:180917948-180917970 ATAGAGGGACCATGGTGAGGAGG - Intronic
918480942 1:184975700-184975722 ACAGAGAGAACAAGGAGTGGTGG - Intergenic
919133727 1:193482811-193482833 AGAGATGAAACATTGTGTGGTGG + Intergenic
919307487 1:195861152-195861174 ACAAAGGCAAGGTGGTGTGATGG - Intergenic
919327684 1:196129718-196129740 AGAGAGGCAATATAGTGTAGTGG + Intergenic
920733577 1:208511308-208511330 AAGGAGGCAGCCTGGTGTGGCGG + Intergenic
921256164 1:213341486-213341508 AGAGAGGCCACATAGAGTGGTGG + Intergenic
921338323 1:214110132-214110154 GCAGAGGCAGAATGGTTTGGGGG - Intergenic
921354712 1:214275174-214275196 AGAGAGGCAGCATGGTGGAGTGG + Intergenic
921700367 1:218262399-218262421 GGAGAGGCAACATGGTGCAGAGG + Intergenic
922034803 1:221838036-221838058 AGAGAGGCAGCATGGTTTTGTGG - Intergenic
922529509 1:226333535-226333557 ACGGAAGCATCCTGGTGTGGTGG - Intergenic
922584626 1:226724242-226724264 ACAGAAGCAAGATGGTCTGCTGG - Intronic
923660715 1:235954816-235954838 ACAGTGAGAGCATGGTGTGGGGG - Intergenic
924070388 1:240272186-240272208 ACAGATGCAACATTATGGGGAGG - Intronic
924114443 1:240731357-240731379 ACAGAGACAATATGGCGTGGTGG + Intergenic
1063180674 10:3596289-3596311 AAATAGGCAGCAGGGTGTGGGGG - Intergenic
1064044115 10:11995839-11995861 ACAGAGGCAACAGTATGTGCAGG - Intronic
1066456537 10:35577179-35577201 ACAGGGACAACACGCTGTGGAGG + Intergenic
1067451850 10:46386587-46386609 ACGGAGGCAGCCTGGTGTGGAGG - Intronic
1067451957 10:46387196-46387218 ACAGAAGCACCATGGGATGGTGG - Intronic
1067585280 10:47472559-47472581 ACAGAAGCACCATGGGATGGTGG + Intronic
1067585388 10:47473168-47473190 ACGGAGGCAGCCTGGTGTGGAGG + Intronic
1067663567 10:48254917-48254939 CCAGAGGCATCTTGGTGTGATGG - Intronic
1067691529 10:48505012-48505034 ACAGAGAAAGCAGGGTGTGGTGG - Intronic
1067813920 10:49456572-49456594 ACAGGTGCAAGATGGTGTGGGGG + Exonic
1067824394 10:49559410-49559432 ACAGAGGTAGCATGGTAGGGAGG + Intergenic
1067930658 10:50558167-50558189 ACAGAGGCAGGAGGGTGTGTTGG - Intronic
1068306584 10:55218266-55218288 AGAGAGGAAATGTGGTGTGGAGG - Intronic
1069508601 10:69023265-69023287 CCAGACGCAGGATGGTGTGGGGG - Intergenic
1069979449 10:72242179-72242201 ACAGAGCCAGAATGCTGTGGGGG + Intergenic
1070432904 10:76359127-76359149 ACAATGACAAAATGGTGTGGTGG - Intronic
1070585227 10:77760407-77760429 TCATAGACATCATGGTGTGGGGG + Intergenic
1070626429 10:78054261-78054283 GCAGAGGCAGATTGGTGTGGGGG + Intronic
1070719737 10:78747778-78747800 GCAGAGGGATCATGGTGTTGGGG - Intergenic
1071224812 10:83516446-83516468 GTAGAGGCAGTATGGTGTGGAGG + Intergenic
1073069941 10:100787021-100787043 CCAGAGGGAACATGGCGTGGGGG + Intronic
1074751936 10:116595200-116595222 ACAGAGCCCACCTGGTGTTGTGG - Intronic
1075906970 10:126089872-126089894 AGAGAGGAAACATGGGGTGAGGG - Intronic
1077280737 11:1744174-1744196 ACAGAGGACACATGGTGAGACGG - Intronic
1077460067 11:2704623-2704645 AGAGAGGCAGCAGGGTGAGGGGG + Intronic
1078589618 11:12628035-12628057 AAAGAGGCAACATGGAGAAGTGG - Intergenic
1078655035 11:13230792-13230814 AGAGAGGCAACATGACTTGGTGG - Intergenic
1078760818 11:14249974-14249996 GGAGAGGCAGCATGGTGTGGAGG - Intronic
1079716904 11:23758571-23758593 ACAGTGGCAACATTGGATGGTGG + Intergenic
1080008451 11:27433763-27433785 ACAGACGCAGCACAGTGTGGTGG + Intronic
1080657105 11:34266772-34266794 ACAGAGGGCACAGGGGGTGGGGG - Intronic
1080866583 11:36200608-36200630 GGAGAGGCAACATGGTGATGGGG + Intronic
1081629828 11:44681602-44681624 ACAGAGGCAAGAGAGGGTGGTGG - Intergenic
1081682800 11:45020305-45020327 ACAGAGGGAACATGGTAGGGAGG + Intergenic
1083160406 11:60850765-60850787 ACAGAGGCAGTGGGGTGTGGAGG - Exonic
1083721315 11:64604969-64604991 TGAGAGGCACCATGGTGGGGAGG + Intergenic
1085282265 11:75339044-75339066 ACTGAGGCCACGTGGAGTGGTGG - Intronic
1087152581 11:94872019-94872041 ACAGAGGCAACCTGGTGCCACGG - Exonic
1088411590 11:109540040-109540062 GCAGTGGCCACATGGTATGGAGG - Intergenic
1088843265 11:113644295-113644317 TCTGAGGCAAGATGCTGTGGGGG - Intergenic
1089072541 11:115711464-115711486 ACAGAAACATCATGGAGTGGTGG + Intergenic
1089339012 11:117745042-117745064 ACAGATGCAACATTGAGTGGGGG + Intronic
1090221059 11:125026397-125026419 ACAGAAGCCACATGGCATGGAGG - Intronic
1090354414 11:126130193-126130215 ACAAGGGCAGCATGGAGTGGGGG + Intergenic
1090633615 11:128672457-128672479 TGTGAGGCAATATGGTGTGGTGG - Intergenic
1091191574 11:133699905-133699927 ACACAGAAACCATGGTGTGGAGG - Intergenic
1091921922 12:4311440-4311462 ACAGAGTCAGGATGCTGTGGTGG + Intergenic
1093891515 12:24526969-24526991 ACAGAGACTGTATGGTGTGGTGG - Intergenic
1098028550 12:66231088-66231110 ACAGAGGCCAAGTAGTGTGGTGG + Intronic
1100196147 12:92247784-92247806 ACAGAGCCAAACTAGTGTGGGGG + Intergenic
1100840722 12:98609430-98609452 ACAGAAGCAACAAGATGTAGGGG - Intergenic
1101337870 12:103812637-103812659 AGAGATGCAACATGGAGTCGAGG + Intronic
1101553876 12:105788598-105788620 ACAAAGGCATCATGCTATGGAGG + Intergenic
1101955499 12:109208912-109208934 AGAAAGCCAGCATGGTGTGGGGG - Intronic
1102081936 12:110105339-110105361 TCAGAGACAACAGGGAGTGGTGG + Intergenic
1102088599 12:110165953-110165975 TCAGAGGCAGCATGGTGGAGTGG + Intronic
1102452860 12:113054744-113054766 ACAGAGGCAGCATGGTGCTATGG + Intergenic
1103053157 12:117798343-117798365 ACAGAGGAAGCTGGGTGTGGTGG + Intronic
1103249676 12:119488825-119488847 TCACAGGCTTCATGGTGTGGTGG - Exonic
1104477160 12:129080322-129080344 AGAGAGACAACAGGGAGTGGTGG - Intronic
1105836332 13:24215423-24215445 ACAGTGGCAAAATGGTCTGTGGG + Intronic
1105883171 13:24621238-24621260 ACAGAGTCAACCTGGGGTGCTGG - Intergenic
1106259499 13:28053095-28053117 ACAGAAGAAACATGGTAGGGTGG + Intronic
1107159503 13:37209596-37209618 AAAGAGGCCACAGTGTGTGGAGG + Intergenic
1108486936 13:50936093-50936115 ACACAGGGAACATGGGCTGGAGG + Intronic
1108637085 13:52345841-52345863 ACAGAGGCAACTTGAGGTGGGGG + Intergenic
1112064022 13:95772033-95772055 ACAGAGACCACATGGTGCGCAGG - Intronic
1112484010 13:99803310-99803332 ACAAAGGCAACATTGTGGGTTGG + Intronic
1114418665 14:22561316-22561338 AGAGAGGCAGCCTGGTGTTGCGG - Intergenic
1117448587 14:55828729-55828751 ACACATGCAAAATGGTGTGGAGG - Intergenic
1117726449 14:58679496-58679518 ACAGAGGCTCTGTGGTGTGGTGG + Intergenic
1117997323 14:61490018-61490040 CCAGGGGTAACATGGTGAGGAGG - Intronic
1118792955 14:69112445-69112467 AGAGAGGGAACTGGGTGTGGTGG + Intronic
1119537830 14:75417309-75417331 ACATAGGCAGCCTGGGGTGGTGG - Intergenic
1121852059 14:97230401-97230423 CCAGAGGCAAGATAGTGAGGGGG - Intergenic
1122297236 14:100712457-100712479 AAAGAGGCAACAGGGAGTGCTGG - Intergenic
1122300677 14:100729294-100729316 CTAGAGGGAACATGGCGTGGGGG + Intronic
1123117179 14:105900008-105900030 ACAGAGGCCACAGGCTGAGGTGG - Intergenic
1125260819 15:37822874-37822896 TCAGAAGCACCATGGTATGGTGG + Intergenic
1125333886 15:38608391-38608413 ACAGAGGCATCATGGGGCAGGGG + Intergenic
1125591796 15:40858905-40858927 ACAGAGGGAGCATGGGGTGCCGG - Intergenic
1126498104 15:49314937-49314959 ACAGGAGCCACATGGTGTGCTGG + Intronic
1126584642 15:50271697-50271719 AGAGAGGCAGCTTGGTGTGGTGG - Intergenic
1126743305 15:51799709-51799731 AAAGTGGCATCAGGGTGTGGGGG + Intronic
1126918000 15:53487360-53487382 CCAAAGGGAACATGGTGTGGTGG - Intergenic
1129951863 15:79599157-79599179 CCAGAGACAACATGGAGTTGTGG + Intergenic
1130453044 15:84076903-84076925 ACAGAGCCAGCTGGGTGTGGTGG + Intergenic
1130542872 15:84834711-84834733 ACAGAGGCCACAGGGTGTGAAGG + Intronic
1130965664 15:88695778-88695800 AAAGAGGCACCTTGGTGTTGGGG - Intergenic
1131196350 15:90358318-90358340 ACTGAGGCAATATAGTGTAGAGG - Intronic
1131217782 15:90553958-90553980 ACAGAGGCTGCATAGTGTGATGG + Intronic
1131597315 15:93811588-93811610 CCAAAGGCAAAATGGGGTGGGGG + Intergenic
1134198380 16:12176879-12176901 ACTGAGGCAGTGTGGTGTGGGGG + Intronic
1134270864 16:12731839-12731861 ACAGAGGCGATATGGGGAGGAGG + Intronic
1135147816 16:19978462-19978484 AAGGAGGCATCATGGTGTGGTGG + Intergenic
1135972084 16:27079650-27079672 AGGGAGGCAACAGGGAGTGGTGG + Intergenic
1137464806 16:48698287-48698309 ACAGAGGGCACCTGGTGTTGTGG + Intergenic
1138098241 16:54230651-54230673 ACAGAGCCAGCTGGGTGTGGTGG + Intergenic
1138773318 16:59690311-59690333 ACAGAATCAAAATAGTGTGGAGG + Intergenic
1140579870 16:76217549-76217571 TCAGTGGCAACCTGGTGTTGGGG + Intergenic
1140947341 16:79781817-79781839 TCAGAGGCAATATGGTGTCATGG - Intergenic
1142530126 17:573790-573812 AGAGACGCAACACAGTGTGGTGG - Intronic
1143439270 17:6955861-6955883 AGAGAGGAAGCAAGGTGTGGAGG - Intronic
1143715936 17:8769033-8769055 ACAGTGGCAACAGGGTGTGCCGG - Intergenic
1144135215 17:12288901-12288923 ACAGAGGGAAGATGATGTGAAGG - Intergenic
1144588536 17:16504113-16504135 ACAGAGGAAATGTGGGGTGGGGG - Intergenic
1145265980 17:21379770-21379792 TCAGAGGCACCATGGGGTTGGGG + Intronic
1146473152 17:33140344-33140366 GGAGAAGCAACATGGTGTAGTGG + Intronic
1146858591 17:36276235-36276257 AAAAAGGCAACCAGGTGTGGTGG - Intronic
1147002497 17:37373938-37373960 CCAGAGGCAAGAGGGTGGGGAGG + Intronic
1147088912 17:38080311-38080333 AAAAAGGCAACCAGGTGTGGTGG - Intergenic
1147108296 17:38240214-38240236 AAAAAGGCAACCAGGTGTGGTGG + Intergenic
1147139010 17:38451233-38451255 ACAGAGGCAGCTGGGTGTGGAGG + Intronic
1147621675 17:41872172-41872194 ACTTAGGCAACCTGGAGTGGGGG + Exonic
1148153997 17:45412310-45412332 TCAGAGGCATGAGGGTGTGGTGG - Intronic
1148286028 17:46392749-46392771 CAAGAGGCAGCATGGTATGGAGG - Intergenic
1148308195 17:46610339-46610361 CAAGAGGCAGCATGGTATGGAGG - Intronic
1148421099 17:47547643-47547665 AAAAAGGCAACCAGGTGTGGTGG - Intronic
1148700409 17:49583345-49583367 GCAGAGGCAAGATGGGGTGGGGG + Intronic
1148714566 17:49706910-49706932 ACTGAGGGAACTTGGGGTGGTGG + Intronic
1149623899 17:58066125-58066147 TGAGAGGCAATATGGTGTAGCGG - Intergenic
1149912050 17:60575672-60575694 ACAAAAGCAGCTTGGTGTGGTGG - Intronic
1149916541 17:60614563-60614585 ACATTGGCAACACGGTGGGGTGG + Intronic
1151414003 17:73949689-73949711 ACAGAGGCAGCGTGGGGTGCTGG + Intergenic
1152116728 17:78392529-78392551 ACACAGGCAGCAAGGTGGGGAGG - Exonic
1153200392 18:2641713-2641735 AAAGAGGCAACATGGTGTTAGGG - Intergenic
1153330153 18:3865630-3865652 GCAGAGGCATCATGTTATGGTGG + Intronic
1155001099 18:21687496-21687518 ACAGAGGCGGCTGGGTGTGGTGG - Intronic
1155927515 18:31672846-31672868 AAAGAGGCTAAATGGTGTGATGG - Intronic
1157242219 18:46021610-46021632 ACAGAGGCATCATCGTATGTAGG - Intronic
1157927415 18:51781349-51781371 ACACAGGCAGCAGGGTATGGGGG - Intergenic
1158228235 18:55222901-55222923 ACAGAGGCAACCAGAAGTGGTGG + Intronic
1158434537 18:57426835-57426857 ACTGAGGAAACCTGGTTTGGGGG - Intergenic
1158741055 18:60142888-60142910 ACAGATGCAAGATGATGAGGAGG - Intergenic
1158945306 18:62442523-62442545 CCAGATGCAGGATGGTGTGGGGG - Intergenic
1161773071 19:6241845-6241867 ACAGAAGCCACATTGTGTGCGGG - Intronic
1162129563 19:8517688-8517710 AAAGAGTCAACAGGATGTGGGGG + Intergenic
1162958822 19:14114304-14114326 CCAGAGGCCACTGGGTGTGGAGG + Intronic
1163062737 19:14772164-14772186 AGAGAGGCAGCGTGGTGTGAAGG - Intronic
1165922111 19:39305605-39305627 CCAGAGGCAGCATAGTGTAGGGG + Intergenic
1166241765 19:41499469-41499491 GCAGTGGCAGCATGGTGGGGTGG + Intergenic
1167483954 19:49749361-49749383 CCAGAGGCCACATGGTGTCATGG - Intronic
1168508382 19:56955123-56955145 ACAGACGCAGCTGGGTGTGGAGG + Intergenic
925458721 2:4042012-4042034 ACAAATGCAACCTGGTGTGCAGG + Intergenic
925790096 2:7475877-7475899 ACAGAGGCTGGATGGTGTGTAGG + Intergenic
926148645 2:10412246-10412268 GCAAAGGCATCATGGTGTGCAGG + Intronic
926410186 2:12594886-12594908 AGAAAGGCAAGATGGTGTTGAGG + Intergenic
926884606 2:17585577-17585599 ACAGGGACAGCATGCTGTGGGGG + Intronic
927198327 2:20563345-20563367 ACAGAGGCAACACTGTGCAGTGG - Intronic
927375791 2:22412010-22412032 ACAGGGGCAGCGTGGGGTGGAGG + Intergenic
927488183 2:23503608-23503630 ACAGAGGCACCATGGCCAGGAGG + Intronic
928247420 2:29643065-29643087 ACAGAGATAAAATGGTATGGGGG + Intronic
928291102 2:30037988-30038010 TCAGAGGCTACACCGTGTGGAGG + Intergenic
928649918 2:33393097-33393119 ACATAGGCAACATGTCATGGGGG + Intronic
929800224 2:45093371-45093393 ACAAAGGCAGCAGGTTGTGGGGG + Intergenic
931158688 2:59664568-59664590 ACAGAGCCAACATGTTTTGAAGG - Intergenic
931158960 2:59667014-59667036 ACAGAGGAAAGATGGTGTGAAGG - Intergenic
932346950 2:71001756-71001778 AAAGAGGGGACATCGTGTGGTGG - Intergenic
935060688 2:99604961-99604983 GCAGAGGCAGCAAGGTGTGTGGG + Intronic
936068199 2:109347974-109347996 ACAGAGGCTGCATGGGCTGGCGG - Intronic
936244114 2:110811576-110811598 TCAGATGGAACATGGTGTTGGGG + Intronic
936656400 2:114493155-114493177 ACAGTGGCAGCAAAGTGTGGTGG + Intronic
937496984 2:122430628-122430650 TCACAGGGAATATGGTGTGGAGG + Intergenic
940424472 2:153514931-153514953 ACAGAGGAAACAGGATGGGGAGG - Intergenic
940681784 2:156794957-156794979 ACAGAGGCAAGAACGTGAGGTGG - Intergenic
941002630 2:160217909-160217931 AAAGAGGCAAATTGGTGTAGGGG + Intronic
941595305 2:167469156-167469178 TGAGAAGCAGCATGGTGTGGTGG + Intergenic
943235907 2:185319269-185319291 ACAGAGACAAGATGGGGTAGGGG + Intergenic
945690141 2:213023838-213023860 ACAGAGGCATCATAATGTGATGG - Intronic
946114253 2:217447587-217447609 ACAGATGGCCCATGGTGTGGAGG + Intronic
947319166 2:228897344-228897366 GAAGAGGCAACATGGAGTGGGGG - Intronic
947880255 2:233502692-233502714 ACAGAGGTGACATGGTTTGGTGG - Intronic
947884589 2:233556995-233557017 AATGAGGCAACATGATGTGCAGG - Exonic
948129046 2:235586754-235586776 TCAGAGGAAACATAGTCTGGGGG + Intronic
948383970 2:237570194-237570216 AGAGAATCACCATGGTGTGGGGG - Intergenic
1170941226 20:20849475-20849497 AAAGAGGCAAAATGGTGTGTGGG + Intergenic
1173199857 20:40946359-40946381 ACAGATGCAGGATGGCGTGGAGG - Intergenic
1173846462 20:46191727-46191749 AGAAAGGCAACATCATGTGGTGG - Intronic
1174780238 20:53382788-53382810 AAAGAGACAACCTGGTGTGTGGG + Intronic
1174781025 20:53388868-53388890 GCAGAGGCAGCCGGGTGTGGTGG - Intronic
1175758240 20:61543969-61543991 ACAGAGCTAAGAGGGTGTGGTGG + Intronic
1176074590 20:63242761-63242783 GCAGAGGGAACATGGCCTGGGGG + Intronic
1176126688 20:63478679-63478701 ACAGAGCGCACAAGGTGTGGGGG + Intergenic
1176151537 20:63593865-63593887 ACAAAGTCAACCGGGTGTGGCGG + Intronic
1177096922 21:16847409-16847431 AGAGAGTCAGCATGGTGTGACGG - Intergenic
1177854851 21:26389073-26389095 ACTGAGACATCATGGTCTGGTGG - Intergenic
1178799435 21:35778764-35778786 ACAGAGGTATCATGGTGTCAAGG + Intronic
1180232958 21:46438463-46438485 ACAGAGGCAACAGAGCCTGGCGG - Intronic
1181280152 22:21714048-21714070 GCAGAGGTCACATGGGGTGGGGG - Intronic
1181437474 22:22919030-22919052 ACAGAGGCCCCTTGGTGGGGAGG - Intergenic
1181548958 22:23625136-23625158 AAAGAGGAAAACTGGTGTGGAGG + Intronic
1181799707 22:25337018-25337040 AAAGAGGAAAATTGGTGTGGAGG - Intergenic
1182464729 22:30507317-30507339 ACAGAGGGAACAGGGTCTTGTGG - Intergenic
1182509784 22:30810642-30810664 ACAGCTGCAACCAGGTGTGGGGG - Intronic
1182966797 22:34529048-34529070 AGAGAGGTAACATGGGCTGGAGG + Intergenic
1183415947 22:37681896-37681918 AGAGAGGCCACTGGGTGTGGAGG + Intronic
1183541345 22:38431063-38431085 GCAGAGGGGACAGGGTGTGGCGG + Intronic
1183645700 22:39124759-39124781 AAAGAGGCAACGGGGCGTGGGGG + Intronic
1183910381 22:41074750-41074772 CCAGAGGCAGGATGGCGTGGGGG + Intergenic
1184504841 22:44894476-44894498 ACAGAGGCAGCATGGGGCTGTGG - Intronic
1184589880 22:45475068-45475090 ACAGGGGCAAGATGAGGTGGGGG - Intergenic
1185079537 22:48701989-48702011 ACAGAGGGGACCTGGGGTGGTGG + Intronic
949192849 3:1270822-1270844 AGAGAGGCAGTATGGTCTGGTGG + Intronic
949753454 3:7381005-7381027 AGAGAGGCATTATGGGGTGGAGG + Intronic
949820388 3:8109806-8109828 AGAGAGGCAAGATGATGTAGGGG + Intergenic
950788612 3:15455228-15455250 GCAGAGGCCACATGGTGGGTGGG - Intronic
951007918 3:17640096-17640118 ACAGAGGATGCAAGGTGTGGGGG + Intronic
952289356 3:32000448-32000470 ACAGAGGCCCACTGGTGTGGTGG - Intronic
953200476 3:40773909-40773931 CAAGAGGCAGCATGGGGTGGTGG + Intergenic
953791898 3:45954046-45954068 ACAGAGGCAACAGTGAGTAGGGG - Intronic
953903863 3:46858498-46858520 GCAGAGGCATGATGGGGTGGGGG + Intronic
955337223 3:58096794-58096816 AAAGAGCCAGCAGGGTGTGGTGG - Intronic
955404189 3:58615467-58615489 ACAGAGACAACATGCTGATGGGG + Intronic
955751032 3:62185556-62185578 GCAGAGGCAACGGGGAGTGGTGG + Intronic
956034773 3:65079188-65079210 ACAGAGGCAAGATAGCATGGTGG - Intergenic
956479455 3:69659495-69659517 ACAGAGGCAACATGGCATGGTGG - Intergenic
956738992 3:72260274-72260296 ACAGAGGCTCCCTGGTGAGGTGG + Intergenic
958105064 3:89061295-89061317 ACAGAGTGAAGATGGTGTTGGGG - Intergenic
960638779 3:119808634-119808656 AAAAAGGCAACATGTTGTAGTGG + Intronic
960666528 3:120114485-120114507 ACATAGGCAACAGGGTGAAGTGG - Intergenic
962829021 3:139123478-139123500 ACAGAGGCAAGAATGTGTGCGGG - Intronic
963243985 3:143043328-143043350 AAAGAGGCAACTTAGTTTGGTGG - Intronic
963344594 3:144079527-144079549 ACAGAACCAACAGGGTGTGTGGG - Intergenic
963986409 3:151599474-151599496 ACAGAGGCAAGAAGGTGGGGAGG + Intergenic
964514002 3:157486498-157486520 AAAGAGGCAGCATAGTTTGGTGG + Intronic
965408051 3:168295046-168295068 ACACAGGTAAGATGATGTGGTGG + Intergenic
966756841 3:183379045-183379067 ACAGAGTAAACATGGTCGGGTGG - Intronic
967471084 3:189863119-189863141 CCAGAGGAAAGATGGTGGGGGGG - Intronic
967787038 3:193508352-193508374 ACAGAGGCAGCATTGTGAAGTGG - Intronic
969522607 4:7687307-7687329 ACAGAGGCGACTTGCTGAGGAGG - Intronic
970362367 4:15322665-15322687 ACAGAGGTAGCTGGGTGTGGTGG - Intergenic
971073322 4:23119868-23119890 AAAGAATCAGCATGGTGTGGTGG - Intergenic
971156482 4:24088545-24088567 ACAGAGGCAAAGTGGTGTTAAGG - Intergenic
971379423 4:26083421-26083443 ACAGAGGGAAGAGGCTGTGGGGG + Intergenic
972569539 4:40297851-40297873 ACAGATGCAAGATGTTGTAGAGG - Intergenic
972599057 4:40555702-40555724 AGAGAGGCAGGATGATGTGGCGG - Intronic
976124057 4:81814834-81814856 TGAGAGGCAGTATGGTGTGGGGG - Intronic
977799314 4:101206943-101206965 ATGGATGCCACATGGTGTGGGGG + Intronic
981241365 4:142480313-142480335 ACAGAGGCAGGAGGGTGGGGAGG + Intronic
981853121 4:149255383-149255405 AGAGAGGCAGCCTGGTGTGGTGG - Intergenic
983316363 4:166137268-166137290 ACAGAGGAAACATGGGGTTCAGG - Intergenic
983618196 4:169731123-169731145 AAAGAGGCAATAAGGTGTAGCGG - Intronic
983970326 4:173863811-173863833 ACAGAGGTGAGATGGTGAGGTGG - Intergenic
986218032 5:5739380-5739402 ACAGAGGAAACGTGGACTGGAGG - Intergenic
987279013 5:16393564-16393586 ACAGAAGCAACATGATTTTGAGG + Intergenic
988908708 5:35817462-35817484 AGGGAGGCAATGTGGTGTGGAGG - Intergenic
989205994 5:38809472-38809494 ACAGAGCCAGCTTGTTGTGGAGG - Intergenic
989667387 5:43872011-43872033 ACACAAGCAACAAGGAGTGGTGG - Intergenic
990466159 5:56073857-56073879 AAAAAGGCAACTTGGTGAGGTGG + Intergenic
990736493 5:58868998-58869020 ACAGAGTCAGCCGGGTGTGGTGG - Intergenic
991943207 5:71875100-71875122 ACAGAGGCATCAGAGAGTGGAGG - Intergenic
995449941 5:112289501-112289523 ACAGAAGTAACACTGTGTGGTGG + Intronic
997061510 5:130509945-130509967 ACAGAGGTAACAAGCAGTGGAGG + Intergenic
997298686 5:132786179-132786201 CCACAGGCAAGATGGTATGGTGG + Intronic
998016388 5:138735491-138735513 ACACAGGCAGCTGGGTGTGGTGG - Intronic
999358154 5:150956773-150956795 GCACAGGCCACATGGAGTGGAGG - Intergenic
1003186797 6:3839204-3839226 GCAGAGGTCACATGGTGAGGGGG + Intergenic
1003461169 6:6329820-6329842 AGAGAGGCCACATGGAGCGGTGG + Intergenic
1003494097 6:6648874-6648896 AGAGAGGCAGGAGGGTGTGGTGG - Intronic
1004078570 6:12368465-12368487 ACATAGTTAACATGGAGTGGTGG + Intergenic
1004566802 6:16805544-16805566 AGAGAGGCAGCATGATGTGTAGG - Intergenic
1004806968 6:19212891-19212913 ACAGAGTCAGCAAAGTGTGGTGG - Intergenic
1006833205 6:36981423-36981445 ACAGAGAGGACATGGTGTCGGGG - Intronic
1007024052 6:38551682-38551704 ACAGAGGCAATATAGTGTATTGG - Intronic
1007985750 6:46205488-46205510 CCAGATGCAAGATGGTGTGAGGG - Intergenic
1010210320 6:73357806-73357828 ACACATTCAACATGCTGTGGAGG - Intergenic
1011464428 6:87640810-87640832 TCAGAGGCAGCTGGGTGTGGTGG + Intronic
1011888314 6:92125766-92125788 AGAGAGGCAGAATGGGGTGGGGG - Intergenic
1012718930 6:102716200-102716222 ACAGAGCCAACATGTTTTGTTGG - Intergenic
1013119374 6:107127658-107127680 ACAGTGGCGACCTGGTGTGGTGG - Intergenic
1014288239 6:119527925-119527947 AGTGAGGCAACGTGGTGTTGAGG + Intergenic
1015854817 6:137612258-137612280 ACTGAGGCAGCATGGTATTGTGG + Intergenic
1015975090 6:138782150-138782172 ACAAAGGCAACATAGAGTAGGGG - Intronic
1016571130 6:145514258-145514280 CCAGAGGCAATATGGAGTCGTGG - Intronic
1016768337 6:147820001-147820023 ACAGAAGAGACAAGGTGTGGTGG + Intergenic
1017967852 6:159281881-159281903 AGAGAGGCAGCATGGTGGAGTGG - Intergenic
1018315731 6:162554618-162554640 ACAGTGGCAACACGGGGTGGGGG + Intronic
1018437906 6:163779615-163779637 ACAGAGGCAGCGTGGTGCAGTGG - Intergenic
1019111629 6:169721934-169721956 AAAGAGGCAATATGGTATAGTGG + Intronic
1019551885 7:1607136-1607158 AGAGAGGAAAGATGGGGTGGGGG - Intergenic
1019642413 7:2111197-2111219 ACACAGACCGCATGGTGTGGGGG - Intronic
1019762911 7:2827003-2827025 ACAGGGGAAAACTGGTGTGGGGG + Intronic
1019838106 7:3410946-3410968 ACAGAGGCTTCATGGTGTAGAGG + Intronic
1021375979 7:19906677-19906699 AAAGAGTTAACATGGGGTGGTGG - Intergenic
1021757412 7:23866728-23866750 ACAGAGGCACCATAACGTGGTGG + Intergenic
1022081702 7:27028849-27028871 ACAAAGGCAGCATGGTGAAGAGG + Intergenic
1022108072 7:27210928-27210950 ACAGAGGCAGGAGGGTATGGCGG - Intergenic
1022175269 7:27866356-27866378 CCAGAGCCCACATGGTGAGGTGG + Intronic
1024216057 7:47248961-47248983 CCAGAGGCTACATGGTGTGCTGG + Intergenic
1024672929 7:51612937-51612959 ACAGAGGCAACATGATATAGTGG + Intergenic
1024775118 7:52775577-52775599 ATGTAGGTAACATGGTGTGGTGG + Intergenic
1026415586 7:70177394-70177416 TCTGAGGTATCATGGTGTGGTGG - Intronic
1026846902 7:73703701-73703723 ACGTAGGGAACATGGTGAGGGGG + Intronic
1026989415 7:74575123-74575145 ACGGAGCCTACATGGTGGGGCGG + Intronic
1027333457 7:77123262-77123284 AGAGAGTCACCATGGTGCGGTGG + Intronic
1029428077 7:100509867-100509889 AGCCAGGCAACAGGGTGTGGTGG + Intergenic
1029533742 7:101143149-101143171 AGAGAGGCAATATGGTGTAGAGG - Intergenic
1029782338 7:102748049-102748071 AGAGAGTCACCATGGTGCGGTGG - Intergenic
1029884436 7:103851935-103851957 ACAGAGGCCACATGCTGAGATGG + Intronic
1030196865 7:106860955-106860977 ACAGAGGCACAGAGGTGTGGTGG + Intergenic
1030266806 7:107629739-107629761 ACAAAGGCACAATGTTGTGGAGG + Intergenic
1031063042 7:117073532-117073554 AAAGAGGCAGCTTGTTGTGGAGG + Intronic
1032528729 7:132602401-132602423 ACAGAGGCAACATGGTCTCTTGG - Intronic
1032999971 7:137493019-137493041 ACACTGGCAAAATGGTATGGGGG - Intronic
1035271194 7:157720959-157720981 ACAGAGGCCCCATGTTGGGGAGG + Intronic
1035871923 8:3144782-3144804 AAAGAGGCAACAAGGGGGGGGGG + Intronic
1037222598 8:16543445-16543467 ATAGAGGTAACTTGGTGTGATGG + Intronic
1038682205 8:29679279-29679301 ACATAGGTAATATGGTGTTGAGG + Intergenic
1039359410 8:36859700-36859722 ACAGAGGAAACATAGAGTGCTGG + Intronic
1041447691 8:57970767-57970789 ACAGAGGGAAGAAGGTGGGGAGG - Intergenic
1044529576 8:93291912-93291934 ACAGAGACAACGAGGTGAGGTGG - Intergenic
1044846536 8:96387418-96387440 ACAGATGAAACATGCTGTGCTGG - Intergenic
1045406733 8:101874154-101874176 AGAGAGGTAACTTGGGGTGGGGG + Intronic
1047685994 8:127305123-127305145 ACAGAGGCAACAGGGATTTGGGG + Intergenic
1048119443 8:131563411-131563433 ACAGAGGCAAGATGCTGATGGGG + Intergenic
1048195470 8:132328414-132328436 AGAGAGACAAGATGGTGAGGTGG + Intronic
1048209705 8:132444455-132444477 AAAAAGACAGCATGGTGTGGAGG + Intronic
1048827152 8:138439403-138439425 ACTGAGGTCACATGGTGTAGTGG - Intronic
1049189754 8:141280479-141280501 CCAAATGCAACATGGTGTTGGGG + Intronic
1049350345 8:142160935-142160957 ACAGAGGCCACAGGGCATGGCGG - Intergenic
1049440671 8:142608117-142608139 GCAGAGGCAACATGGGGCCGTGG + Intergenic
1049650344 8:143764114-143764136 AGACAGGAAACATTGTGTGGAGG + Intergenic
1050359994 9:4821094-4821116 ACAGAGGCAAACTAGTGTCGTGG + Intronic
1050361018 9:4831142-4831164 AGACAGGCAACTTGGTGCGGTGG - Intronic
1050561100 9:6834967-6834989 CCAGATGCAGGATGGTGTGGGGG - Intronic
1051521799 9:17997598-17997620 ACAGAGGCATCGCTGTGTGGAGG - Intergenic
1051721158 9:20039120-20039142 AAGGAGGCGGCATGGTGTGGTGG + Intergenic
1051850159 9:21497104-21497126 ACAGAGGGAAAATGGAGTGGGGG + Intergenic
1052697180 9:31892534-31892556 CCAGCGGCAGCATGGTCTGGTGG + Intergenic
1052972254 9:34384055-34384077 ACATATGCGACACGGTGTGGAGG + Intronic
1053087404 9:35237532-35237554 ACAGAAGCCACATGCAGTGGAGG + Intronic
1053261657 9:36671414-36671436 ACAGGGGCAACATGGAGGTGAGG + Intronic
1054896849 9:70323065-70323087 TTCGAGGCAACATGGTGTAGTGG + Intronic
1054942848 9:70762850-70762872 ACAGAGGCAACATGGTGTGGTGG - Intronic
1055128999 9:72753422-72753444 ATGGAGGCAGCATGGTGTGGGGG - Intronic
1055233963 9:74096617-74096639 ACAGTGGCAAAATAGCGTGGTGG + Intergenic
1056340095 9:85620742-85620764 TAAGAGACAACAGGGTGTGGTGG + Intronic
1056954057 9:91068471-91068493 ACAGAACCAATAGGGTGTGGGGG + Intergenic
1059529700 9:115024326-115024348 ACAGAAGCAGCATAATGTGGTGG + Intronic
1060067319 9:120513980-120514002 CCTGAGGAAACATGGTGGGGTGG - Intronic
1060442376 9:123654018-123654040 TAAGAGGCAAGTTGGTGTGGTGG - Intronic
1060464437 9:123890228-123890250 GGACAGGCAACGTGGTGTGGTGG - Intronic
1060699896 9:125741550-125741572 ACAAAATCAACATGGTTTGGTGG - Intergenic
1061529164 9:131196682-131196704 ACAGAGGCAGTACGGTCTGGTGG - Intronic
1187229895 X:17410901-17410923 ACAAAGACAATATGGTGTGCTGG - Intronic
1188127859 X:26392632-26392654 ACAAATGCAACATGATGTGAAGG + Intergenic
1188392940 X:29643597-29643619 ACAGAGGAATCATGAAGTGGAGG - Intronic
1189146329 X:38658783-38658805 ACAGAGGCAACATGTTCAGAAGG - Intronic
1189957292 X:46288603-46288625 CCAGAGGCAAGATGGCATGGGGG + Intergenic
1191713932 X:64181090-64181112 GCAGAGGACACATGGTGTAGGGG + Intergenic
1192214559 X:69149661-69149683 AGAGAGGCAAGATGGTGTAGTGG + Intergenic
1192496189 X:71617929-71617951 AGAGAGGCCACACGGTGGGGGGG - Intronic
1193258283 X:79376256-79376278 ACTGAGGCAGCATGGTGCGGTGG - Intergenic
1193790167 X:85807935-85807957 GCAGAGGCAGCATGGCTTGGGGG + Intergenic
1194552426 X:95318871-95318893 TCATAGACAACATTGTGTGGTGG + Intergenic
1194754754 X:97725471-97725493 AGAGATGAAAAATGGTGTGGTGG + Intergenic
1195638220 X:107142676-107142698 AGAGAGGCAACATGGGGTGAGGG - Intronic
1195882012 X:109602208-109602230 AGAGGGGGAACATGGTGAGGGGG - Intergenic
1196158259 X:112454521-112454543 GAAGAGGCAACATTGAGTGGCGG + Exonic
1196282817 X:113843320-113843342 ACAGAAGAAACATTTTGTGGTGG - Intergenic
1196691452 X:118563119-118563141 ACAGAGCCAGGGTGGTGTGGTGG + Intronic
1197846528 X:130810170-130810192 ACTGAGGCAGCCTGGTGTTGGGG - Intronic
1198632103 X:138651828-138651850 AGTGAGGCCACATGGGGTGGAGG + Intronic
1198793579 X:140372062-140372084 AGGGAGGCAATATGGTGTGATGG + Intergenic
1199370511 X:147042474-147042496 ACAGTGGGAACACTGTGTGGGGG - Intergenic
1200820530 Y:7578034-7578056 AAACAGGCAACTTGATGTGGTGG + Intergenic
1201230876 Y:11863084-11863106 AAACAGGCAACTTGATGTGGTGG + Intergenic