ID: 1054942851

View in Genome Browser
Species Human (GRCh38)
Location 9:70762863-70762885
Sequence TTGCCTCTGTTTACACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054942844_1054942851 24 Left 1054942844 9:70762816-70762838 CCTAGTTCTTCTGAATATTTGTC 0: 1
1: 0
2: 1
3: 24
4: 325
Right 1054942851 9:70762863-70762885 TTGCCTCTGTTTACACCAAGTGG No data
1054942847_1054942851 2 Left 1054942847 9:70762838-70762860 CCAGGGCTCTTTCCACCACACCA 0: 2
1: 3
2: 27
3: 164
4: 685
Right 1054942851 9:70762863-70762885 TTGCCTCTGTTTACACCAAGTGG No data
1054942848_1054942851 -10 Left 1054942848 9:70762850-70762872 CCACCACACCATGTTGCCTCTGT 0: 1
1: 0
2: 1
3: 38
4: 366
Right 1054942851 9:70762863-70762885 TTGCCTCTGTTTACACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054942851 Original CRISPR TTGCCTCTGTTTACACCAAG TGG Intronic
No off target data available for this crispr