ID: 1054953170

View in Genome Browser
Species Human (GRCh38)
Location 9:70876780-70876802
Sequence CTGGGTAAAGAATGGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054953170 Original CRISPR CTGGGTAAAGAATGGGTTGT GGG (reversed) Intronic
900834833 1:4993707-4993729 CTGGGTGAAGAATGAGTTGTAGG - Intergenic
901526344 1:9825157-9825179 CTGGGTGGAGACTGGTTTGTGGG + Intergenic
901700303 1:11041731-11041753 ATGGGTGAAGAATGGGTGGGTGG + Intronic
903009716 1:20320955-20320977 CAGGGAGAAGAGTGGGTTGTGGG + Intronic
903886376 1:26543267-26543289 CTGGGCAAGGAATGGGTTTGGGG + Intronic
904553649 1:31342759-31342781 CTGTTTAAAGAAAGGGTTCTAGG + Intronic
905965268 1:42088186-42088208 ATGGGTATGTAATGGGTTGTTGG + Intergenic
905999344 1:42410484-42410506 CTGGGTAAAGGATGGAATGATGG + Intronic
906257762 1:44363490-44363512 CTTGGAAAAGAATGGGTTCAAGG - Intergenic
908571690 1:65418138-65418160 CTGGAGACAGAATGGGTGGTTGG + Intergenic
908749743 1:67409356-67409378 CTGAGTTAAGAATGGTTTTTAGG - Intronic
909656129 1:78034525-78034547 CTTGGTAAAACATGGATTGTGGG + Intronic
909932593 1:81514542-81514564 CTGCGCAAAAAATGTGTTGTGGG - Intronic
910937592 1:92497807-92497829 CTGGTTAAAGACTGGCTTGGTGG + Intergenic
911549518 1:99262852-99262874 CTGCGTAGGGAATGGTTTGTAGG + Intergenic
913497829 1:119444673-119444695 CTGAGTAAACAATGGGTTGTGGG - Intergenic
915381195 1:155442250-155442272 CTGTCTAAAGAATGAGTTGGAGG - Intronic
916377277 1:164168845-164168867 CTGGGTAAATAATGAGATGAAGG + Intergenic
917482583 1:175424734-175424756 CTGGGTAGAGAATGGGAAGCAGG - Intronic
917606582 1:176637353-176637375 CTGGGTGCAGGATGGGTTGGAGG + Intronic
919973832 1:202598221-202598243 CTGGGTAAATGATGGACTGTGGG + Intronic
920191046 1:204194085-204194107 CTGGGTGAGGAATGGGGGGTGGG - Intronic
920319575 1:205108633-205108655 CTGGGTAAAGTATCGGTTTTGGG - Intronic
920364026 1:205438680-205438702 CTGGGTGAAGAAGGGGCTGCCGG + Intronic
920843392 1:209573871-209573893 CAGGGAAGAGAATTGGTTGTGGG - Intergenic
922345971 1:224696611-224696633 CTGGGCATTGTATGGGTTGTGGG + Intronic
922823064 1:228497546-228497568 CTGGGTTGAGAATGCATTGTTGG - Intergenic
923517400 1:234709273-234709295 CTGTGTGGAGAATGGGTTGAAGG + Intergenic
924746373 1:246837541-246837563 CTAGGTAAAGAATGGATTGGGGG + Intergenic
1065081380 10:22133148-22133170 CTATGGAAAGAATGGATTGTGGG - Intergenic
1065635002 10:27722772-27722794 CTGGGTAGAGGCTGGGTTGAAGG - Intronic
1069619694 10:69829253-69829275 CTGTGTAAAGAAGGGTTTGGAGG - Intronic
1071129104 10:82370652-82370674 CAGTGAAAAGAATGGGTTTTAGG - Intronic
1071412477 10:85410591-85410613 CTGGGAAAAGAATGTGTTCCTGG + Intergenic
1072221174 10:93328814-93328836 CTTCGGAAAGGATGGGTTGTGGG + Exonic
1073205122 10:101765060-101765082 CTGAGTGCAGAATGGATTGTAGG + Intergenic
1073625517 10:105091783-105091805 CTGGGAGAAGAATGAGATGTAGG + Intronic
1074810577 10:117100988-117101010 CTTGGTAAAGACTGGATTTTAGG + Intronic
1075322004 10:121499007-121499029 CTGGGTTAAGAATGCTTGGTCGG - Intronic
1077579451 11:3407522-3407544 CTGGCTTGAGCATGGGTTGTTGG + Intergenic
1077788327 11:5410008-5410030 CTGTGTATAGAATGGGATGTTGG - Intronic
1078036474 11:7810639-7810661 CTGGGAAAAGAATGCGTTCCTGG - Intergenic
1078878467 11:15423003-15423025 CTGGGAAAGGAATGGGTCGGGGG + Intergenic
1079280477 11:19082848-19082870 CTGGGGAAAGAATGGTGAGTAGG - Intergenic
1079671828 11:23180410-23180432 CTGGGTAGAGAGAGGGTTATAGG + Intergenic
1079744754 11:24110779-24110801 CTGGGTGAAGATTGAATTGTGGG + Intergenic
1079909374 11:26290650-26290672 CTGGGTAAATAATGAATTGAAGG - Intergenic
1081952886 11:47060643-47060665 CCGGGGAAAGGATGGGTTGGGGG + Intronic
1082051911 11:47777351-47777373 CTGGGTTGAGCATGGGTTCTAGG + Intergenic
1083471226 11:62885389-62885411 ATGGGAGAAGAAAGGGTTGTTGG + Intronic
1084470186 11:69354891-69354913 CTGGGGAATGAATGGGGGGTGGG + Intronic
1085198096 11:74684174-74684196 CTGTGTAAAGGAGGGGTTGAAGG + Intergenic
1085323975 11:75592663-75592685 CTGTATGAAGAATGGGTTGGAGG - Intronic
1085324615 11:75596962-75596984 CTGGACAAGGAATGGGTTTTAGG + Intronic
1085382197 11:76130153-76130175 CCAGGTAAAGAATGGGTTGGTGG - Intronic
1086742808 11:90388466-90388488 GTGGGCAAAGCATGGGTTCTAGG - Intergenic
1087363937 11:97195970-97195992 CTGGGTAAATAATGGAATGAAGG - Intergenic
1087719981 11:101651765-101651787 CTGGGAAAGGAATAGGTTTTAGG + Intronic
1089316983 11:117598684-117598706 CTGGGTGGAGAAGGGGTTGAAGG + Intronic
1089509416 11:118986726-118986748 TTGAGTAAAGATTGGGTTATTGG + Intergenic
1090943067 11:131405655-131405677 CTGTTTGAAGAATGGATTGTAGG - Intronic
1091770657 12:3149004-3149026 CTGGGTAAATTGTGGGGTGTGGG + Intronic
1092245419 12:6861420-6861442 CTGGTGACAGAATGGGTTGGTGG - Intronic
1092438695 12:8476847-8476869 CTGGGTAAAGACTGGGAGGTTGG - Intronic
1092569116 12:9702452-9702474 ATGGGTAGAGGATGGGGTGTGGG + Intergenic
1093139664 12:15494136-15494158 GTGGGAAAAGAATGGGGTTTGGG + Intronic
1093314893 12:17637138-17637160 CAGGGAATAGAATGGGTTGCAGG - Intergenic
1093858144 12:24130539-24130561 TTGAGTAAAGAATGGTTTGCTGG + Intergenic
1094005065 12:25740553-25740575 CTGGGTGGAGACTGGATTGTAGG + Intergenic
1095305452 12:40633543-40633565 TTGGGCAAAGAATGTGATGTAGG + Intergenic
1095850451 12:46798126-46798148 TTGGGTAAAGAATGAATGGTGGG - Intronic
1097863120 12:64537647-64537669 CTGGGTAAAGATTGAGTTCTGGG - Intergenic
1099010596 12:77286753-77286775 CTGGGGAAAGAAGTGGCTGTGGG + Intergenic
1099046740 12:77729882-77729904 CTGGGTAAAGAAGGAGTTGATGG - Intergenic
1099425508 12:82518494-82518516 ATGGGTACAGGATGGGGTGTGGG + Intergenic
1099779698 12:87177816-87177838 CAGTGTAGAGAATGGATTGTTGG + Intergenic
1100395266 12:94180557-94180579 CTGGGTACATAATGGGTGTTGGG + Intronic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101493353 12:105230693-105230715 CTGGGTAGAGCATGTGTGGTGGG - Intronic
1101630210 12:106485702-106485724 TTGGGTAAAGAATAGTTTTTTGG + Intronic
1101931153 12:109015341-109015363 CTGGGTTGAGAATGGGCTATAGG + Intronic
1102940458 12:116936945-116936967 CTGTGTGGAGAATCGGTTGTTGG + Intronic
1105478783 13:20754237-20754259 CTGGGTATAGAATCTTTTGTTGG + Intronic
1106210790 13:27642609-27642631 CTGGGGAATAAATGGGTTCTGGG - Intronic
1108412513 13:50164099-50164121 CTGGGTGAGGAATGGCTTGTAGG + Intronic
1108684270 13:52805200-52805222 ATGGGGAAAGAATGGGCTGTGGG - Intergenic
1110139257 13:72107187-72107209 CTGGGGAAAGGATGGGAGGTGGG - Intergenic
1111126548 13:83916606-83916628 CTGGGTAAAAAATAGATTATAGG - Intergenic
1111453894 13:88454149-88454171 ATGGGTACAGAATGGGGGGTGGG + Intergenic
1111926946 13:94473754-94473776 CTGTGAAAAGAATGGGAAGTGGG + Intronic
1112819779 13:103318871-103318893 CTGGTAAAACAATGGGTTATGGG + Intergenic
1112910432 13:104476330-104476352 CTTGGTTAAGAATCGGTTGGTGG + Intergenic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1115015086 14:28601604-28601626 CTGGGTAAAGTATGCACTGTGGG + Intergenic
1115369772 14:32599989-32600011 CTGGGGTAAGAATTGGTTGAAGG - Intronic
1115479981 14:33851180-33851202 CTGTGAAAAGAATGGATTGGAGG + Intergenic
1115513261 14:34159214-34159236 CTGGGTAAAGAATGAGTTGAAGG + Intronic
1115635539 14:35287243-35287265 CTGGGTAAAGAAAGGGACGTAGG - Intronic
1115833448 14:37369739-37369761 GTGTTTAAAGAAGGGGTTGTTGG - Intronic
1116928811 14:50669386-50669408 CTGGTTAATGAATGAATTGTGGG - Intergenic
1117490292 14:56240358-56240380 CTGGGTAAATGATTGGATGTGGG + Intronic
1119178868 14:72590590-72590612 CTAGGTGAAGAAGGGGTTGCAGG + Intergenic
1120140008 14:80919467-80919489 CTGGGTGAAGGAGGGGTGGTTGG - Intronic
1121243982 14:92449666-92449688 CTGGACAAAGCATGGGTTCTCGG + Intronic
1122635853 14:103129348-103129370 CTGGGTGAAGAAGGAATTGTTGG + Intronic
1123012189 14:105354857-105354879 TTGGGTAAAGGATGGGCTCTGGG + Intronic
1124947564 15:34284075-34284097 CTGGTTTGAGAATGGATTGTAGG + Intronic
1126564201 15:50077719-50077741 GTGGGCAAAGAAGGGGGTGTGGG - Intronic
1127124785 15:55801384-55801406 CTGGGTAAAGAACTGGAAGTGGG - Intergenic
1127596062 15:60483245-60483267 CTGGGTAGAAAAGGGGTTGTGGG + Intergenic
1127899784 15:63332540-63332562 CTGGGGAAAGAATGGGTGGTGGG + Intronic
1127994577 15:64145770-64145792 CTGGGGAAAGAATGTCTTGCAGG - Intronic
1128105733 15:65043369-65043391 CTGGGTGGAAAATGGATTGTAGG - Intergenic
1128184399 15:65632186-65632208 CTGAGTAGAGAATGAATTGTAGG + Intronic
1128818257 15:70629906-70629928 CTGGATGAAGAGTGGGATGTGGG - Intergenic
1129833434 15:78685654-78685676 CTGGGGGAAAAATGGCTTGTGGG + Intronic
1129903024 15:79166222-79166244 CTGGGGACAGAGTAGGTTGTGGG + Intergenic
1132821594 16:1875028-1875050 CTGGCTAAAGAAACGGTAGTTGG + Intronic
1133838727 16:9389256-9389278 CTGCATGGAGAATGGGTTGTAGG + Intergenic
1134689739 16:16183419-16183441 CTGGGTGGAGGATGGGCTGTGGG - Intronic
1135797934 16:25463508-25463530 ATGAGTAAAGAATGGGTTTTGGG + Intergenic
1136354915 16:29738179-29738201 AGGGGTAGAGAATGAGTTGTTGG + Intergenic
1137260360 16:46822751-46822773 CTGTGTAGAGAATAGTTTGTAGG - Intronic
1137985263 16:53101955-53101977 CAGTGTAAGGAATGGGTCGTAGG + Intronic
1138982816 16:62291387-62291409 CTGGGTAAAGAATTTCATGTAGG - Intergenic
1139301261 16:65947256-65947278 CTGGCTAAAGAATGAGTGGATGG + Intergenic
1139447469 16:67006722-67006744 CTGGGGGCAGAATGGGATGTGGG - Intronic
1142328103 16:89431545-89431567 CTGGGAAGAGAGTGGTTTGTAGG - Intronic
1144229807 17:13190638-13190660 CTGTGTGAAGAATGGATTGTTGG + Intergenic
1147509606 17:41056133-41056155 GTAGCTAAAGAATGGATTGTAGG + Intergenic
1150067256 17:62121529-62121551 CTGGGTAACAAATGAGTTCTGGG + Intergenic
1150294157 17:63998877-63998899 GGGGGTGAAGAATGGGTTGGCGG - Intronic
1153004094 18:481965-481987 ATGGGTAAATTGTGGGTTGTGGG + Intronic
1153812763 18:8766320-8766342 CTAGGTGAAGCATGAGTTGTCGG + Intronic
1156169746 18:34468324-34468346 CTGAGTAAAGTATGGGCTTTAGG - Intergenic
1156498010 18:37538520-37538542 CTGGGTAAAGACAGCGTTGTGGG - Intronic
1156501837 18:37565157-37565179 CTGGGGCAAGACTGGGTTTTGGG - Intronic
1159852612 18:73543697-73543719 TTGGGTAAAAAATAGATTGTTGG - Intergenic
1159873533 18:73785557-73785579 CTGCTTAGAGAATGGGTTATGGG - Intergenic
1160201703 18:76801782-76801804 CTGGGCAAAGAAGGGGCTGCAGG + Intronic
1160767876 19:816466-816488 CTGGGTAATGAATGGATGGATGG - Intronic
1162158699 19:8696710-8696732 CGGGGTAGAGACTGGGTTGGGGG + Intergenic
1164428359 19:28165109-28165131 CTGGATAATGAATGGTCTGTGGG - Intergenic
1165533634 19:36424636-36424658 CTAAGTAAAAAATGTGTTGTTGG + Intergenic
1165930625 19:39356150-39356172 CTGGGTAGAGGATGGATGGTCGG - Intronic
1165988266 19:39789712-39789734 CAGGGGAAAGAATGGGATGGAGG + Intergenic
1166119910 19:40680059-40680081 GTGGGTAAAGAATGTGATGTTGG - Intronic
1167529936 19:50008910-50008932 CTGGGCAAAGACTGTGTTGAGGG + Intronic
1167624622 19:50579359-50579381 CTGTGTGGAGAATGGATTGTAGG - Intergenic
1167822229 19:51938573-51938595 CTGGTAAGGGAATGGGTTGTTGG + Intronic
925640707 2:5983646-5983668 CTGGGGACAAAATGGTTTGTAGG + Intergenic
925830547 2:7889930-7889952 CTGTGGAAAGAAGGGGTCGTAGG + Intergenic
929367919 2:41183466-41183488 CTAGGTAGAGGATGTGTTGTGGG - Intergenic
930151161 2:48061372-48061394 CTGGGTAAAGAATGGGACTGGGG - Intergenic
930674978 2:54190853-54190875 CTGGGTAAGGAATGAGTTGGGGG - Intronic
931599414 2:63988978-63989000 CTGGGAAAAGAATGCATTCTCGG + Intronic
932895000 2:75630992-75631014 CAGGGGAGAGAATGGGTTGAAGG + Intergenic
933994911 2:87661139-87661161 ATGGGGAGAGAATGGGTTGTGGG - Intergenic
934612882 2:95753825-95753847 CTGGGTACAGCCTGTGTTGTAGG + Intergenic
934841399 2:97626420-97626442 CTGGGTACAGCCTGTGTTGTAGG - Intergenic
936298947 2:111289774-111289796 ATGGGGAGAGAATGGGTTGTGGG + Intergenic
937256232 2:120557772-120557794 CTGGGTAGAGAATGGATGGTAGG - Intergenic
937727514 2:125185647-125185669 CAGGGTAAACAAGGTGTTGTAGG + Intergenic
938657677 2:133451210-133451232 CAGAGTAAAGAATGGCTTCTGGG - Intronic
939889893 2:147723827-147723849 CTGAGTAAAGAATGGATTGAAGG - Intergenic
940478967 2:154203845-154203867 CTGCATAAATAATGGATTGTAGG - Intronic
940546257 2:155090373-155090395 CATTGTAAAGAATGGGCTGTTGG + Intergenic
940845612 2:158638615-158638637 CTGTATAAAGAATGGATTGGGGG + Intronic
945901996 2:215549144-215549166 ATGTTTAAAGAATGAGTTGTTGG - Intergenic
946718430 2:222578236-222578258 CTGGGTAAAGAACCATTTGTTGG - Intronic
946912448 2:224477767-224477789 CTGGGTAAAGTATTGGTAGAGGG - Intronic
947176390 2:227371734-227371756 CTGGGAAAAGAAAGGCTAGTGGG - Intronic
947696502 2:232194744-232194766 CTTGGTAAGGACTGGGCTGTGGG + Intronic
1169715096 20:8607132-8607154 CTGGCTGAGGAATGGGATGTGGG - Intronic
1169796098 20:9464180-9464202 CTGGGTAAATAATGGAATGAAGG + Intronic
1171097631 20:22347050-22347072 GTGGGTAAAGAAAGCGTTTTGGG - Intergenic
1171879581 20:30608441-30608463 CTGGATAAACAATGGGGAGTTGG - Intergenic
1172040968 20:32045645-32045667 CTGGGTAGAGAATGAATTGGAGG - Intergenic
1172303250 20:33864253-33864275 CTGAGTGGAGAATGGTTTGTAGG - Intergenic
1172457291 20:35087463-35087485 CTGGTGACAGACTGGGTTGTGGG - Intronic
1173071643 20:39774026-39774048 GTGGGTAAAGAATAAGATGTGGG - Intergenic
1173735451 20:45358247-45358269 CTGGGTAACAAAGGGGTTTTCGG + Intergenic
1174368463 20:50070555-50070577 CTTGGCAAAAAATGGGTTGGAGG + Intergenic
1174502096 20:50992808-50992830 CAGGGTAGAGAATGGGTCGGGGG - Intergenic
1175072493 20:56346066-56346088 CTGGGTAGAGAATGAGTTGGAGG - Intergenic
1177468284 21:21519259-21519281 TTGTGTGAAGAATGGGTTATTGG + Intronic
1178360718 21:31946970-31946992 CTGGCTTGAGAATGGGATGTGGG - Intronic
1178360725 21:31947008-31947030 CTGGCTTGAGAATGGGATGTGGG - Intronic
1178789612 21:35687858-35687880 ATGGGTAGAGAATGGATTGGAGG - Intronic
1179312610 21:40210023-40210045 CTGGGTAAAGAAGGAGTTAGTGG - Intronic
1180194851 21:46187151-46187173 CTGGTTAAAAAATGGGCTGAAGG - Intergenic
1181970240 22:26684362-26684384 CTGGGTGCAGAATGGATTGGAGG + Intergenic
1182761619 22:32726854-32726876 CTTTGTTGAGAATGGGTTGTGGG - Intronic
1183009805 22:34935547-34935569 CTGTGTAGAGAATGGATTGGAGG - Intergenic
1184325097 22:43776910-43776932 CTATGTAAAGAATGGATTATAGG + Intronic
1184414770 22:44345823-44345845 CTGGGTGAATGATGGGTGGTGGG + Intergenic
949213603 3:1536953-1536975 CTGGGTAAAGAATGCATTCCTGG + Intergenic
950036349 3:9888641-9888663 CTGTGTAGAGAATGGCTTGCAGG - Intergenic
951730765 3:25808133-25808155 CTGGGTTGAGAATAGGTTGTGGG - Intergenic
952262337 3:31752693-31752715 CTGGGTAAAGCAAGGGCTGCGGG + Intronic
954828204 3:53394037-53394059 CTGGGTAAAGAATGAAATGAAGG + Intergenic
955122954 3:56079820-56079842 CTGTGTTAAGAATAGGCTGTAGG + Intronic
960872680 3:122265625-122265647 TTGATTCAAGAATGGGTTGTTGG - Intronic
962658844 3:137579925-137579947 CTGGGGAAGGAAAGGATTGTTGG + Intergenic
966936852 3:184716251-184716273 ATGGGCAAAGCAAGGGTTGTTGG - Intergenic
967779275 3:193418558-193418580 CTGGCTAGAGAGTGGGGTGTTGG - Intronic
968709781 4:2105342-2105364 CTGAGCAGAGAATGGGTTGTAGG - Intronic
969443627 4:7232171-7232193 CTGGGGGAAGCATGGGCTGTGGG + Intronic
969571697 4:8012577-8012599 ATGGGTGAAGAATGGGTGGATGG - Intronic
971358802 4:25917773-25917795 CTAGGTAGAGAATGGGTAGTAGG - Intronic
974695242 4:65359783-65359805 CTGGGTTAAGAAGAGGTGGTAGG - Intronic
974986545 4:69034349-69034371 CTGGGAAAAGAATGCATTGGGGG + Intronic
976200133 4:82569877-82569899 CAGGGTAAAGACTGGGCAGTTGG - Intergenic
977047991 4:92091000-92091022 CTGGGTAAAGAATGGGGTTGAGG - Intergenic
978972459 4:114826466-114826488 CTGGAGGAAGAATAGGTTGTTGG + Intergenic
978980650 4:114940953-114940975 ATGGGTACAGGATGGGGTGTGGG + Intronic
979310777 4:119200558-119200580 CTGGGTAAAGAATGAAATGAAGG + Intronic
979796238 4:124850148-124850170 CTGGGTTAAGGGTGGTTTGTTGG + Intergenic
980215540 4:129848428-129848450 CTTTGTAAATAATAGGTTGTTGG - Intergenic
981135282 4:141204042-141204064 GTGGATAAAGACTGGGGTGTTGG + Intronic
981847393 4:149185046-149185068 ATGGGTTAATAATGGGTTGGTGG - Intergenic
984905983 4:184626145-184626167 CTGGGAAAAGAATGCATTCTGGG - Intergenic
985293788 4:188412981-188413003 CTATATAAAGTATGGGTTGTAGG - Intergenic
986864855 5:11974404-11974426 TTTGGTAAAGGATGGGTTTTAGG - Intergenic
987140971 5:14945888-14945910 GTGGGTAAAGCATGGGAGGTGGG - Intergenic
990525652 5:56624376-56624398 CTGTGTAGAGAATGGATTGTAGG + Intergenic
990526303 5:56631280-56631302 CTGTGTAGAGAATGGATTGCAGG + Intergenic
991994829 5:72376600-72376622 CTGGGTAAAGAGTGTGCTCTTGG + Intergenic
992309476 5:75480974-75480996 CTGTGTTAAGAATAGATTGTAGG - Intronic
992699701 5:79329656-79329678 GTGGGTATAGAATGAGTTGCAGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994446463 5:99880053-99880075 CTTGGTAAACACTGGGTGGTAGG - Intergenic
1001233552 5:170010331-170010353 CTGGGTAAGGACTGGGATATAGG + Intronic
1002854745 6:1026876-1026898 GTGGGTAGAGACTGGGATGTGGG + Intergenic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1003910372 6:10738488-10738510 CTGGGTAAAGAATGACTTATAGG - Intergenic
1004374528 6:15080028-15080050 CTGAGTAAAGACAGGCTTGTGGG + Intergenic
1004672107 6:17807340-17807362 CTGGGAAAGGAATGCATTGTGGG + Intronic
1004673764 6:17822008-17822030 CTGGGTAAAGGATGGGGTAGGGG + Intronic
1004783001 6:18933181-18933203 CTGTGTAAAGAGTGGATTCTTGG + Intergenic
1006112718 6:31758387-31758409 TTGGATAAAGAATGGGATGGTGG + Intronic
1007011460 6:38422333-38422355 GAAGGAAAAGAATGGGTTGTAGG - Intronic
1007136472 6:39526608-39526630 CCTGATAAAGAAGGGGTTGTGGG - Intronic
1007249569 6:40486535-40486557 CTGGGTAAGGAATGGGTAGAGGG + Intronic
1008009305 6:46446329-46446351 CTGGGTAAAGAATTCTTGGTTGG - Intronic
1008085083 6:47235933-47235955 GTGGGTAGAGAATGGATTTTAGG + Intronic
1010992869 6:82499681-82499703 CTGGGTAAAGAATGAAATGAAGG - Intergenic
1011224518 6:85092223-85092245 CTGTGTGGAGAATGGATTGTAGG + Intergenic
1011527918 6:88286363-88286385 CTGGGTAAAGTATTCTTTGTTGG + Intergenic
1012451847 6:99361071-99361093 CTGGGTCAGGAATGGGTTCATGG + Intergenic
1012811406 6:103964046-103964068 CTGGGTAAGGAATGGGTGTCAGG - Intergenic
1017787945 6:157772027-157772049 CTGGCTGAAGGATGGGTTGGGGG + Intronic
1019043430 6:169124850-169124872 ATGGGTACAGAATGGGGAGTGGG - Intergenic
1020081574 7:5288880-5288902 GTGGGTAAAGGATGGGAGGTAGG - Intronic
1020279263 7:6642185-6642207 CTGGGTACAGAATGTCTTGATGG + Intronic
1021887888 7:25157801-25157823 CTGGATAAAGCATGGATTTTGGG + Intronic
1022917263 7:34970724-34970746 TTGGATAAAGAATGCGCTGTGGG + Intronic
1024772162 7:52736149-52736171 CTGTGTAGAGAATGGGCTGAGGG + Intergenic
1026974940 7:74491698-74491720 CTGGGTAAAGAAAATGTGGTAGG - Intronic
1027909689 7:84234226-84234248 CTAGGAAAAGATTAGGTTGTAGG - Intronic
1028385737 7:90251033-90251055 CTGGGAGAAGACTGGGTTGGAGG - Intronic
1030440425 7:109582168-109582190 ATGGGTAAAAAAAGGTTTGTTGG + Intergenic
1030450389 7:109702492-109702514 TTGGGAAAAGAGTGGGTTGAAGG + Intergenic
1032518360 7:132523652-132523674 CTGTGTAGAGAATGGTTTTTGGG + Intronic
1033893146 7:146040200-146040222 CTGGGTAAATAATGAAATGTAGG - Intergenic
1036083830 8:5590831-5590853 CTGTGTAAAGGAAGGGTTGGAGG - Intergenic
1039144246 8:34427906-34427928 CTGTGCTAAGATTGGGTTGTAGG - Intergenic
1042253580 8:66780860-66780882 CTGGGGAAAAAATGGATTGGAGG + Intronic
1044189135 8:89293892-89293914 CTGTGTGGAGCATGGGTTGTAGG - Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1047035302 8:120931881-120931903 CTGTGTAGGGAATGGTTTGTAGG + Intergenic
1047455078 8:125000788-125000810 CTGTATGGAGAATGGGTTGTAGG + Intronic
1049581767 8:143415166-143415188 CTGGGTATAGAATTTGCTGTTGG - Intergenic
1050020591 9:1280284-1280306 CTGGGGAAGGGATGGGCTGTTGG + Intergenic
1051042979 9:12837029-12837051 CTGGGTAATGAATAGGTTTATGG + Intergenic
1051729939 9:20130729-20130751 CTAAGTGAAGAATGTGTTGTAGG + Intergenic
1052289339 9:26824141-26824163 ATGGGTACAGGATGGGGTGTGGG + Intergenic
1052750335 9:32483607-32483629 CTGGGTAGAGTATGGGTTAGAGG - Intronic
1053236791 9:36462382-36462404 CTGTGCTGAGAATGGGTTGTAGG - Intronic
1054640747 9:67538623-67538645 CTTGTTTAAGAATGTGTTGTTGG - Intergenic
1054953170 9:70876780-70876802 CTGGGTAAAGAATGGGTTGTGGG - Intronic
1055770907 9:79716038-79716060 CTGGGTGAAGAATGGAGTGTAGG - Intronic
1056193639 9:84208529-84208551 CTCAGTGAAGAATGGCTTGTAGG - Intergenic
1056870263 9:90270888-90270910 ATGGGTAAATTATGTGTTGTGGG + Intergenic
1058263223 9:102863373-102863395 CTGGTTGAAGAATGGGGTATTGG - Intergenic
1058588159 9:106532517-106532539 CAGGGGACAGAAAGGGTTGTGGG + Intergenic
1059650933 9:116315274-116315296 CTGGGTTCAGGATGGGTTTTCGG - Intronic
1185918290 X:4060883-4060905 ATAGATAAAAAATGGGTTGTTGG + Intergenic
1186030970 X:5368667-5368689 CTATGTAAAGAATGGGTTATAGG - Intergenic
1186234881 X:7497473-7497495 CTGGGTGCTGAATGGGTGGTAGG - Intergenic
1187549294 X:20285125-20285147 CTGGGTGAAGAATGCATTATAGG - Intergenic
1189361213 X:40353669-40353691 CTGGGGAAAGATGGGGATGTGGG - Intergenic
1190559460 X:51672722-51672744 GGGGGAAAAGAATGAGTTGTAGG + Intergenic
1190564831 X:51720599-51720621 GGGGGAAAAGAATGAGTTGTAGG - Intergenic
1191219672 X:57974770-57974792 CTTGGTAAACAATGAGTTCTAGG + Intergenic
1191853688 X:65605495-65605517 TATTGTAAAGAATGGGTTGTAGG - Intronic
1191871231 X:65747284-65747306 CTGTGTGAAGAATGGACTGTAGG - Intergenic
1192173064 X:68868615-68868637 CTGTGTGGAGAATAGGTTGTGGG + Intergenic
1195418043 X:104641673-104641695 TGGGATAAAGAATGGGATGTGGG - Intronic
1195700878 X:107704718-107704740 CTGGGTAATGGATTGGATGTAGG + Intergenic
1196196217 X:112840812-112840834 CTGGGCAAAGGATGGGAGGTAGG + Intronic
1197455120 X:126670097-126670119 CTGGGTGAAGAATGGTTTCCTGG - Intergenic
1198019086 X:132641018-132641040 TTGGGTGAGGAAGGGGTTGTGGG - Intronic