ID: 1054954494

View in Genome Browser
Species Human (GRCh38)
Location 9:70893183-70893205
Sequence TCCCCACAGGTCCTCCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054954492_1054954494 5 Left 1054954492 9:70893155-70893177 CCAATAATGCTTTTTCTAATGAA 0: 1
1: 0
2: 2
3: 35
4: 453
Right 1054954494 9:70893183-70893205 TCCCCACAGGTCCTCCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054954494 Original CRISPR TCCCCACAGGTCCTCCAGAT TGG Intronic
No off target data available for this crispr