ID: 1054957360

View in Genome Browser
Species Human (GRCh38)
Location 9:70928070-70928092
Sequence ATCTGGATATTTAGGTAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054957356_1054957360 -8 Left 1054957356 9:70928055-70928077 CCATATTTGTAGGCCATCTGGAT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG No data
1054957352_1054957360 6 Left 1054957352 9:70928041-70928063 CCAACTAATTGTTCCCATATTTG 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG No data
1054957355_1054957360 -7 Left 1054957355 9:70928054-70928076 CCCATATTTGTAGGCCATCTGGA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054957360 Original CRISPR ATCTGGATATTTAGGTAATA GGG Intronic
No off target data available for this crispr