ID: 1054957758

View in Genome Browser
Species Human (GRCh38)
Location 9:70932933-70932955
Sequence CAGAAGAGATGGTGAGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054957753_1054957758 23 Left 1054957753 9:70932887-70932909 CCATAAAAGGCCATTTTTATACT 0: 1
1: 0
2: 3
3: 23
4: 285
Right 1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG No data
1054957755_1054957758 13 Left 1054957755 9:70932897-70932919 CCATTTTTATACTTTAGGCTAGA 0: 1
1: 0
2: 0
3: 21
4: 231
Right 1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054957758 Original CRISPR CAGAAGAGATGGTGAGAAGT AGG Intronic
No off target data available for this crispr