ID: 1054962462

View in Genome Browser
Species Human (GRCh38)
Location 9:70983894-70983916
Sequence CTATGTAGAGTAACCAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054962462_1054962470 14 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG No data
1054962462_1054962471 15 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962471 9:70983932-70983954 GGGTGGTTACTGCAGATTGTGGG No data
1054962462_1054962466 -6 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962466 9:70983911-70983933 ACATAGCAGGTTGGCTTCCTGGG No data
1054962462_1054962467 -5 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962467 9:70983912-70983934 CATAGCAGGTTGGCTTCCTGGGG No data
1054962462_1054962468 -2 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962468 9:70983915-70983937 AGCAGGTTGGCTTCCTGGGGTGG No data
1054962462_1054962465 -7 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962465 9:70983910-70983932 TACATAGCAGGTTGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054962462 Original CRISPR CTATGTAGAGTAACCAGTCC AGG (reversed) Intronic
902250358 1:15151010-15151032 CCACGTAAAGTAACCAGTTCTGG + Intergenic
902688679 1:18095995-18096017 CTATGTAAAGCACCCAGCCCTGG + Intergenic
903538136 1:24080999-24081021 CTAGGGTGAGTAACTAGTCCTGG - Intronic
905499167 1:38422459-38422481 TTATCTACAGTAACCAGCCCAGG - Intergenic
906778619 1:48552463-48552485 CTATGTAGAGTAAACAAAACAGG + Intronic
910464870 1:87487977-87487999 CTATGTTCAGTAACCTGTCTGGG + Intergenic
917636312 1:176940246-176940268 TTATCTAGAGTAACCAGCCTAGG + Intronic
922854599 1:228763684-228763706 CTATCTAGAGAAACCAGCACAGG - Intergenic
923365343 1:233255071-233255093 TTATCCAGAGTAACCAGCCCAGG + Intronic
1070598840 10:77851683-77851705 TTATGTGGAGTAACCAGGGCAGG - Intronic
1073582261 10:104679467-104679489 AGAGGTAGAGTAACCAGTCCAGG + Intronic
1077832075 11:5884350-5884372 ATATGTAAAGTGTCCAGTCCTGG - Exonic
1080237350 11:30086532-30086554 TTATCTATAGTAACCAGCCCAGG - Intergenic
1081015443 11:37872371-37872393 CTATATAGAGTAAACAGTCTTGG - Intergenic
1083040257 11:59679202-59679224 CTTTGTAAATTACCCAGTCCCGG + Intergenic
1086620557 11:88883064-88883086 CTTTATAGATTAACCAGTCTTGG + Intronic
1086878166 11:92122760-92122782 CTATGCAGAGAAACCACTCCTGG + Intergenic
1087243448 11:95806770-95806792 CTCTGTAGACTAACCTCTCCGGG + Intronic
1087590191 11:100177342-100177364 CTATGTAGTGTAATCAATTCTGG - Intronic
1092355871 12:7794758-7794780 CAATGTGGAGCAACCAGACCTGG + Exonic
1092368497 12:7896929-7896951 CAATGTGGAGCAACCAGACCTGG - Intergenic
1092368704 12:7898566-7898588 CAATGTGGAGCAACCAGACCTGG + Intergenic
1095406434 12:41871428-41871450 CTAACTAGAATAACCAGTTCAGG + Intergenic
1098497015 12:71147999-71148021 CTATTTAGTGTAATCAGTCTTGG + Intronic
1101974271 12:109341869-109341891 TTTTCTACAGTAACCAGTCCAGG - Intergenic
1107778647 13:43875571-43875593 TTATCTACAGTAACCAGTCCAGG + Intronic
1112586102 13:100720375-100720397 TTATATACAGTAACCAGCCCAGG + Intergenic
1114926257 14:27403071-27403093 CTTTGTAAATTACCCAGTCCCGG + Intergenic
1118239410 14:64041980-64042002 CTATGTAGAGTAAAAATTACTGG - Intronic
1121148158 14:91604717-91604739 CAATGTGGAGCAACCAGACCTGG - Intronic
1122851458 14:104534728-104534750 TTATCTATAGTAACCAGCCCAGG + Intronic
1124072512 15:26409156-26409178 CTATGTAGAGGAGCCAAACCGGG + Intergenic
1124383152 15:29184690-29184712 CTATGCAGCGAAACCAGCCCGGG + Intronic
1125032241 15:35084508-35084530 CAATGTGGAGCAACCAGACCTGG - Intergenic
1125349146 15:38749699-38749721 CAAAGTAGGGAAACCAGTCCGGG + Intergenic
1129025678 15:72571448-72571470 TGATGTATAGTAACCACTCCAGG + Intronic
1129319092 15:74763903-74763925 GGAGGTAGAGTTACCAGTCCAGG - Intergenic
1130739917 15:86588215-86588237 CTGTGTAGAGTAGCCAACCCAGG - Intronic
1133492215 16:6281346-6281368 CTATGCAGAGTAACACTTCCCGG - Intronic
1140587483 16:76310051-76310073 CTATCTACAGGAGCCAGTCCAGG - Intronic
1141342851 16:83219027-83219049 CTTTGTAAATTACCCAGTCCCGG + Intronic
1143266822 17:5644219-5644241 CTATGGAAAGAAACCAGGCCTGG + Intergenic
1143800500 17:9375995-9376017 CTATGTAAAGTGTCCAGTGCTGG - Intronic
1145017720 17:19410093-19410115 CTATGTAAAGCCACTAGTCCAGG - Intergenic
1145070846 17:19806360-19806382 CTTTGGAGATTAACCAGTACAGG - Intronic
1146092434 17:29893245-29893267 CTAACTAGAGTACCTAGTCCTGG + Intronic
1146336424 17:31975641-31975663 CTATTTAGAGTGACTCGTCCAGG + Exonic
1150538988 17:66076675-66076697 CTATGGAGAGGAACCAGTGGTGG - Intronic
1153986634 18:10356820-10356842 CTGTTTACAGTAACCAGTTCAGG + Intergenic
1153986665 18:10357056-10357078 CCATCTACAGTAACCAGTGCAGG + Intergenic
1153986671 18:10357090-10357112 CCATCTACAGTAACCAGCCCAGG + Intergenic
1153986676 18:10357124-10357146 CCATCTACAGTAACCAGTGCAGG + Intergenic
1153986682 18:10357158-10357180 CCATCTACAGTAACCAGCCCAGG + Intergenic
1153986687 18:10357192-10357214 CCATCTACAGTAACCAGTTCAGG + Intergenic
1154232449 18:12569542-12569564 CTATGCAAAGTCACCTGTCCAGG - Intronic
1156946529 18:42839839-42839861 ATATCTATAATAACCAGTCCAGG + Intronic
1158020700 18:52837816-52837838 CTTTGTAAATTACCCAGTCCCGG - Intronic
1159611245 18:70527682-70527704 CTATCTCTAGCAACCAGTCCAGG - Intergenic
1161598678 19:5166615-5166637 CTCTGTAGATTGACCTGTCCTGG - Intronic
1168450513 19:56462851-56462873 CTATGAAGAATAAACAGGCCAGG + Intronic
925889728 2:8423966-8423988 CTTTATAAATTAACCAGTCCTGG - Intergenic
928582940 2:32726786-32726808 CTATGTAAATTACCCAGTCTTGG - Intronic
930969066 2:57371435-57371457 CTATCCACAGCAACCAGTCCAGG - Intergenic
931824757 2:65988943-65988965 CTTTGTAAATTACCCAGTCCTGG - Intergenic
932634525 2:73376863-73376885 ATATCTACAATAACCAGTCCAGG + Intergenic
933488529 2:82953504-82953526 CTATGTATAGATACCAGTTCTGG - Intergenic
934729674 2:96648697-96648719 TTATCTACAGTAACCAGCCCAGG - Intergenic
935684171 2:105669026-105669048 ATATCTACAGTAACCAGCCCAGG - Intergenic
938977837 2:136496061-136496083 CTATCTGTAGCAACCAGTCCCGG - Intergenic
940367473 2:152864013-152864035 CTATCTCTATTAACCAGTCCAGG - Intergenic
941436821 2:165482842-165482864 GAATGTAGATTAAACAGTCCTGG - Intronic
942811735 2:180007940-180007962 GTGTGTGGAGAAACCAGTCCTGG - Intergenic
943685934 2:190818291-190818313 ACATGCAGACTAACCAGTCCAGG - Intergenic
943719747 2:191191342-191191364 CTATCTACAGTAACCAGTTCAGG - Intergenic
944421716 2:199537624-199537646 CTAACTAGAATAACCAGTTCAGG + Intergenic
946079995 2:217109657-217109679 CTATGTGGAGTGAGCAGTTCAGG + Intergenic
946705299 2:222452705-222452727 CAATGTGGAGCAACCAGACCTGG - Intronic
946814993 2:223567718-223567740 ATTTGTAGAGTAAACACTCCGGG - Intergenic
1169901094 20:10552229-10552251 CTCTGCAGAGTGACCAGTTCTGG + Intronic
1174606260 20:51763894-51763916 CTATGTAGAGCATTCTGTCCAGG - Intronic
1174935074 20:54858508-54858530 CTATCTATAGTAACCAGCCCAGG - Intergenic
1175001495 20:55634005-55634027 CTCTGTAGAGTATGCAGTCCTGG + Intergenic
1175210858 20:57353520-57353542 CTACCTAGAACAACCAGTCCGGG - Intronic
1177393938 21:20509858-20509880 CTTTGTAGATTACCCAGTCTTGG - Intergenic
1179453131 21:41479006-41479028 CTGCTTAGAGTAACCAGGCCTGG + Intronic
1179549537 21:42135313-42135335 CCATGGGGAGTAACCATTCCTGG + Intronic
949180359 3:1122651-1122673 CTATGTAGATTTATCAGTTCTGG + Intronic
950088805 3:10280198-10280220 CTATGCAGAATAAGCAGGCCTGG + Exonic
953951542 3:47194403-47194425 CTATCTTTAGCAACCAGTCCAGG - Intergenic
958154744 3:89742342-89742364 GTATGTAGAGATACCAGTCCAGG + Intergenic
961473317 3:127132017-127132039 GTATGGAGAGTAACCAGCCGGGG + Intergenic
964192398 3:154018445-154018467 CTATGCAGAGAACCCGGTCCAGG + Intergenic
964248297 3:154680716-154680738 CTATTTAGAGTAAACAGGCATGG + Intergenic
965964758 3:174473851-174473873 CTTTATAAATTAACCAGTCCTGG - Intronic
967355011 3:188559350-188559372 ATATGTAGTGTAACCTGTTCAGG + Intronic
967413429 3:189190690-189190712 TTGTGTAGAGTAAGCAGGCCTGG + Intronic
967507808 3:190272898-190272920 TTATGTACAGTAAACAGACCAGG - Intergenic
970127318 4:12829314-12829336 CTCTGTAGATTACCCAGTCTTGG + Intergenic
970246781 4:14072386-14072408 ATATCTACAGTAACCAGTGCAGG + Intergenic
970246799 4:14072505-14072527 ATATCTACAGTAACCAGCCCAGG + Intergenic
970246812 4:14072571-14072593 ATATCTACAGTAACCAGCCCAGG + Intergenic
970246850 4:14072801-14072823 ATATCTACAGTAACCAGCCCAGG + Intergenic
970246857 4:14072834-14072856 ATATCTACAGTAACCAGCCCAGG + Intergenic
970246868 4:14072900-14072922 ATATCTATAGTAACCAGCCCAGG + Intergenic
972158982 4:36199108-36199130 CTCTGTAGAGTATGCAGCCCTGG + Intronic
972575381 4:40346342-40346364 CAATGCAGAGAAACCATTCCTGG - Intronic
973587884 4:52410583-52410605 TTATCTACAGTAACCAGTCCAGG - Intergenic
973587890 4:52410617-52410639 CTGTCTACAGTAACCAGCCCAGG - Intergenic
973587909 4:52410749-52410771 TTATCTATAGTAACCAGCCCAGG - Intergenic
974036056 4:56819472-56819494 TTATTTAGAATAACCAGGCCAGG + Intronic
975841161 4:78475585-78475607 CTATGTAGAGTATGCTGGCCAGG + Intronic
976611856 4:87038921-87038943 CTATGTGAAGTGACCAGTCAAGG + Intronic
980563773 4:134510915-134510937 CTGTCTACTGTAACCAGTCCAGG + Intergenic
981267839 4:142807481-142807503 CTATGTAGCATAAACTGTCCAGG - Intronic
984277393 4:177627019-177627041 TTATGTTGAGTGACCAATCCAGG + Intergenic
990947807 5:61267383-61267405 CTCTGTAGATTACCCAGTCTTGG + Intergenic
994018213 5:94993438-94993460 CTATGAAGAGAAAATAGTCCTGG - Intronic
996662703 5:126022914-126022936 CTATCTATAGTAACCAGTACAGG - Intergenic
998061499 5:139122190-139122212 CTATGTAAAGTACCCAGCACGGG - Intronic
998114699 5:139527237-139527259 CTATGTATAGAAACTGGTCCGGG - Intronic
1001380757 5:171304936-171304958 CTTTGTAGTCTAAACAGTCCTGG + Intergenic
1003675571 6:8201474-8201496 TTATCTATAGTAACCAATCCAGG - Intergenic
1003887280 6:10533004-10533026 TTCTGTAAAGTAACTAGTCCAGG + Intronic
1003918626 6:10810742-10810764 CTATTTAGAGTAAGAAGTACTGG - Intronic
1009046059 6:58238607-58238629 TTATCTACAGTAACCAGACCAGG - Intergenic
1009221869 6:60992918-60992940 TTATCTACAGTAACCAGACCAGG - Intergenic
1014028850 6:116678925-116678947 CTATATTTAGCAACCAGTCCAGG - Intergenic
1014276643 6:119396685-119396707 CTATGAAGAGAATCCAGTCTGGG + Intergenic
1016849342 6:148601194-148601216 TTATCTACAGTAACCAGCCCAGG + Intergenic
1016951592 6:149586092-149586114 CTTTATAAAGTAACCAGCCCAGG - Intronic
1018380249 6:163252430-163252452 CTAGGAAGAGAATCCAGTCCAGG + Intronic
1018917853 6:168148284-168148306 CAGTGAAGAGTAACGAGTCCAGG + Intergenic
1021757258 7:23864444-23864466 CTATTTAGAGTAAAAGGTCCTGG + Intergenic
1022312788 7:29212879-29212901 CAATGTGGAGCAACCAGACCTGG + Intronic
1022772623 7:33490905-33490927 CTTTGTTGGGTAGCCAGTCCTGG + Intronic
1027909040 7:84224811-84224833 CTATGTAGAGTTACCAGCTATGG - Intronic
1029617750 7:101670269-101670291 CTTTATAGATTACCCAGTCCCGG - Intergenic
1032782253 7:135172716-135172738 CTATGTACAGAAACCGGTCTGGG - Intergenic
1035405678 7:158595607-158595629 CTTTGTAGATTACCCAGTCTCGG - Intergenic
1036610622 8:10346844-10346866 CTGTTTAGAGTCACCAGTTCAGG - Intronic
1037605231 8:20432849-20432871 CTTTGTAAATTATCCAGTCCCGG - Intergenic
1041225137 8:55690120-55690142 CTTTGTAAAGTAACCAGTCTTGG + Intergenic
1041700249 8:60781017-60781039 CTTTCTAGAGAAACCAGTGCCGG + Exonic
1047996915 8:130345658-130345680 CTATGTAAAGTACTCAGTACAGG + Intronic
1048229626 8:132625597-132625619 CCATGCAGGGTAACCAGGCCTGG - Intronic
1051476138 9:17511029-17511051 CTATTAAGAGTACCAAGTCCTGG - Intergenic
1054962462 9:70983894-70983916 CTATGTAGAGTAACCAGTCCAGG - Intronic
1056509695 9:87291802-87291824 CTCTGTAGATTAACCTGTTCTGG - Intergenic
1061718420 9:132536322-132536344 TTTTGTACAGTAACCAGCCCAGG - Intronic
1061944593 9:133901662-133901684 CTAGGTAGAGTCACCAGGCCGGG - Intronic
1189670925 X:43407958-43407980 CAATGTGGAGCAACCAGACCTGG - Intergenic
1189682852 X:43534829-43534851 TTATCTACAGTAACCAGCCCAGG + Intergenic
1195399782 X:104448847-104448869 CTATGCAGAGACACCAGGCCTGG - Intergenic
1198347523 X:135773409-135773431 CTAAGCAGAGAAACCAATCCAGG - Intergenic
1198349428 X:135790670-135790692 CTAAGCAGAGAAACCAATCCAGG - Intergenic
1198353242 X:135825209-135825231 CTAAGCAGAGAAACCAATCCAGG - Intergenic
1198355149 X:135842463-135842485 CTAAGCAGAGAAACCAATCCAGG - Intergenic
1198358973 X:135877025-135877047 CTAAGCAGAGAAACCAATCCAGG - Intergenic
1198365447 X:135935256-135935278 CTAAGCAGAGAAACCAATCCAGG - Intergenic
1198944833 X:141999258-141999280 CTATGAGGAAAAACCAGTCCTGG - Intergenic