ID: 1054962470

View in Genome Browser
Species Human (GRCh38)
Location 9:70983931-70983953
Sequence GGGGTGGTTACTGCAGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054962462_1054962470 14 Left 1054962462 9:70983894-70983916 CCTGGACTGGTTACTCTACATAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1054962470 9:70983931-70983953 GGGGTGGTTACTGCAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054962470 Original CRISPR GGGGTGGTTACTGCAGATTG TGG Intronic
No off target data available for this crispr