ID: 1054969251

View in Genome Browser
Species Human (GRCh38)
Location 9:71065965-71065987
Sequence CTGAACCAGCACAGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054969249_1054969251 -2 Left 1054969249 9:71065944-71065966 CCAACAAATGCAGACATAAAACT 0: 1
1: 0
2: 2
3: 16
4: 311
Right 1054969251 9:71065965-71065987 CTGAACCAGCACAGCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054969251 Original CRISPR CTGAACCAGCACAGCCATCT GGG Intronic
No off target data available for this crispr