ID: 1054974008

View in Genome Browser
Species Human (GRCh38)
Location 9:71121383-71121405
Sequence CCATTAGGGCAGAGGCTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 265}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054974001_1054974008 4 Left 1054974001 9:71121356-71121378 CCATGGTCATCTCCACACCTGCA 0: 1
1: 0
2: 0
3: 24
4: 336
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1054973996_1054974008 22 Left 1054973996 9:71121338-71121360 CCCCACGGCTCTGGCATCCCATG 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1054973997_1054974008 21 Left 1054973997 9:71121339-71121361 CCCACGGCTCTGGCATCCCATGG 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1054973995_1054974008 23 Left 1054973995 9:71121337-71121359 CCCCCACGGCTCTGGCATCCCAT 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1054973999_1054974008 20 Left 1054973999 9:71121340-71121362 CCACGGCTCTGGCATCCCATGGT 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1054974002_1054974008 -8 Left 1054974002 9:71121368-71121390 CCACACCTGCAAATTCCATTAGG 0: 1
1: 0
2: 1
3: 22
4: 212
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265
1054974000_1054974008 5 Left 1054974000 9:71121355-71121377 CCCATGGTCATCTCCACACCTGC 0: 1
1: 0
2: 0
3: 23
4: 179
Right 1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG 0: 1
1: 0
2: 2
3: 29
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054974008 Original CRISPR CCATTAGGGCAGAGGCTTCC TGG Exonic
900946991 1:5836649-5836671 CCTTCAGGACAGGGGCTTCCTGG - Intergenic
903255888 1:22099227-22099249 CAGTTAGGGCAGAGCCCTCCTGG - Intergenic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903466249 1:23554507-23554529 TCGAGAGGGCAGAGGCTTCCCGG + Intergenic
904287487 1:29461673-29461695 GGATTGGGCCAGAGGCTTCCTGG - Intergenic
904324376 1:29718472-29718494 TCCTCAGGGCAGAGGCTTCTGGG + Intergenic
904370748 1:30046039-30046061 GGATTGGGCCAGAGGCTTCCTGG - Intergenic
904725238 1:32541795-32541817 CCATGAGGGCAGAGTCTTCGTGG + Intronic
905372780 1:37494071-37494093 ACATTAGTGCAGAAGCTTCCAGG - Exonic
906472892 1:46145879-46145901 CCATTTGGGCAGAGAATTCCAGG + Intronic
906958385 1:50396975-50396997 CCATTAGGGCAGAGTCCTCATGG + Intergenic
907493949 1:54829445-54829467 CAAGTAGGGCAAAGGCTTCATGG - Intronic
907628473 1:56055569-56055591 CCATGAGAGCAGAGCCCTCCTGG - Intergenic
908427434 1:64021104-64021126 CAATTAGGGCAGAGGCTAGGAGG - Intronic
912777200 1:112513327-112513349 CCATCAGGGCAACAGCTTCCAGG - Intronic
913034762 1:114953107-114953129 CCATAAGGGCAGAGCCCTCATGG + Intronic
914796721 1:150926225-150926247 GCGTTAAGGCAGAGCCTTCCAGG - Intergenic
917685248 1:177409272-177409294 CCATTAGGGCAAAGGATTTCTGG - Intergenic
918071737 1:181138241-181138263 CCATTGGGGATGATGCTTCCAGG + Intergenic
918310828 1:183284065-183284087 GCATTAGGGAACAGGCTTCCTGG + Intronic
918748010 1:188231055-188231077 TCATGAGGGCAGAGACTTCATGG + Intergenic
919942415 1:202297464-202297486 TCATTAGGGCAAAGGCTTAATGG - Intronic
920108984 1:203573942-203573964 CCTGTAGGACAGAGGCTGCCTGG + Intergenic
922025683 1:221746453-221746475 TCATGAGGGCAGAGGCCTCATGG + Intergenic
923148847 1:231216596-231216618 GCATCAGGGCAGAGCCGTCCCGG - Exonic
924009086 1:239644550-239644572 GCTTTAGGGCAGAGAATTCCAGG + Intronic
924582254 1:245332633-245332655 CCAGCAGGGCTGTGGCTTCCAGG - Intronic
924690738 1:246347642-246347664 CCATGAGGACAGAGCCTTCATGG - Intronic
1062825984 10:568999-569021 GCATGAGGGCAGCGGCTTCCTGG + Intronic
1062964451 10:1596547-1596569 CCATCAGGACAGAGGCTTGCAGG + Intronic
1065259099 10:23906121-23906143 CCATGAGGGCAGAGCCTTATGGG + Intronic
1065502369 10:26394902-26394924 CCAATAGGGAAGGGGCTACCTGG + Intergenic
1067238392 10:44470423-44470445 CCATGTGGACAGAGGCTGCCTGG + Intergenic
1067989504 10:51194929-51194951 TCATGAGGGCAGAGTCTTCATGG + Intronic
1068382022 10:56267399-56267421 TCATGAGGGCAGAGTCTTCATGG - Intergenic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1069134127 10:64742772-64742794 TCATGAGGGCAGAGCTTTCCTGG + Intergenic
1070730592 10:78825267-78825289 TCATGAGGGCAAAGGCCTCCTGG - Intergenic
1070769379 10:79073460-79073482 CACTGAAGGCAGAGGCTTCCAGG - Intronic
1071060469 10:81564534-81564556 CCATTTGAGCAAAGACTTCCTGG + Intergenic
1071576491 10:86730407-86730429 CCAGTAGGTCAGAGTCTGCCAGG - Intronic
1071952178 10:90716191-90716213 CCATTTGAGGAGTGGCTTCCTGG - Intergenic
1073150916 10:101310849-101310871 CAATCAGCGCAGAGGCTTCAGGG + Intergenic
1074444466 10:113507987-113508009 TCATGAGGACAGAGGCTTCATGG - Intergenic
1074903807 10:117842616-117842638 TCCTTAGGGCAGAGACTTCAGGG - Intergenic
1075859975 10:125667029-125667051 CCTTCAGGGCAGAGGCCTGCAGG + Intronic
1075907284 10:126092727-126092749 CCATTTGGGCAGAGGCTTCAGGG - Intronic
1075916184 10:126169393-126169415 CCATTAGGGCAGAGTCTGTCTGG + Intronic
1077161050 11:1113071-1113093 CCTTTAAAGCAGAGGCTACCCGG + Intergenic
1077719529 11:4613719-4613741 TCATGAGGGCAGAGCCCTCCTGG + Intergenic
1078519378 11:12051085-12051107 CCCTTGGGGAAGAGGTTTCCTGG + Intergenic
1078601476 11:12735323-12735345 GCATTAGGGGAAGGGCTTCCTGG + Intronic
1078837939 11:15049550-15049572 CCATGAGGGAAGAGCCTTCATGG + Intronic
1080337324 11:31212967-31212989 CTAGGAGGGCAGAGGCATCCAGG - Intronic
1081870336 11:46380283-46380305 GCCTTCGGGAAGAGGCTTCCTGG + Exonic
1082797320 11:57387648-57387670 CCTTTGTGGGAGAGGCTTCCTGG - Intronic
1083736173 11:64682567-64682589 TCATTGGTGCAGAGGCTTTCAGG - Intronic
1084194689 11:67517820-67517842 CCATAAGGGCAGAGCCCTCATGG - Intergenic
1084496293 11:69505601-69505623 CCCTGATGGCAGAGGCATCCTGG - Intergenic
1084694218 11:70744247-70744269 CCACAAGGGCAGGAGCTTCCTGG - Intronic
1084766530 11:71312644-71312666 CTTTTAGGGCTGAGGTTTCCAGG + Intergenic
1087632341 11:100664962-100664984 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1088278584 11:108114984-108115006 CCATGAGGGCAGAGCCCTCGTGG - Intergenic
1088740853 11:112765721-112765743 CCATTAGAGGAGAGCCTTGCAGG + Intergenic
1089000427 11:115047589-115047611 GCATTATTGCAGTGGCTTCCTGG + Intergenic
1090041035 11:123291592-123291614 CCATTAGGCAAGAGGCTGCGGGG + Intergenic
1090280506 11:125452098-125452120 CCATAAGGGAAGAGGCCTGCTGG - Intronic
1090667444 11:128924261-128924283 CCCTTATGGAAGAGGCTTCAGGG - Intergenic
1091341132 11:134814839-134814861 TCATGAAGGCAGAGGCTTCCAGG - Intergenic
1091349617 11:134882451-134882473 CCATGAGGGCAGAAGCTTTATGG - Intergenic
1096396251 12:51269156-51269178 CCACCTGGGCTGAGGCTTCCAGG + Intronic
1096523196 12:52195551-52195573 CCATTTGGCCTGAGGCCTCCTGG + Intergenic
1097119525 12:56720727-56720749 CCCTTCAGGCTGAGGCTTCCTGG + Exonic
1097575362 12:61386474-61386496 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1101207708 12:102505326-102505348 TCATGAGGGCAGAGCCTTCATGG - Intergenic
1101822695 12:108196042-108196064 GCATCTGGGCAGAGGTTTCCGGG + Exonic
1102199882 12:111049876-111049898 CCACTAGGACAGGGGCTCCCTGG + Intronic
1103234157 12:119358305-119358327 CCATGAGGGTGGAGGCTTTCTGG - Intronic
1103874622 12:124117251-124117273 CCATTTGGGCAGAGAATTCTGGG - Intronic
1106204614 13:27579852-27579874 ACATGATGGCAGAGGCCTCCTGG - Intronic
1107787747 13:43971534-43971556 GCCTTCGGGAAGAGGCTTCCTGG + Intergenic
1112118086 13:96379318-96379340 TCATGAGGGCAGAGCCCTCCCGG + Intronic
1114355797 14:21906806-21906828 CAATTAGGGCAGCTGCTTCTCGG - Intergenic
1114551039 14:23533060-23533082 GCATCAGGGGATAGGCTTCCAGG + Exonic
1116203216 14:41825660-41825682 ACATTAGGGCTGAGATTTCCTGG + Intronic
1118326573 14:64785581-64785603 TCAGTAGGACAGAGGCCTCCTGG + Exonic
1119757641 14:77130117-77130139 CCATTCTGGCAGAGGTTTCTGGG - Intronic
1120261717 14:82193713-82193735 CATTAAGTGCAGAGGCTTCCAGG + Intergenic
1121049745 14:90812593-90812615 CCACGAGGGCCTAGGCTTCCGGG + Intronic
1122791595 14:104186146-104186168 ATTTCAGGGCAGAGGCTTCCAGG + Intergenic
1122825946 14:104370504-104370526 CCTTTGGGGCTGAGGGTTCCAGG + Intergenic
1202902299 14_GL000194v1_random:50824-50846 CCAGGAGCCCAGAGGCTTCCTGG + Intergenic
1124715459 15:32056497-32056519 CCATTAGGGCACAGGCATAGTGG - Intronic
1127362695 15:58259031-58259053 CCATAAGGGCAGAGCCGTCATGG - Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1136409864 16:30069945-30069967 CCTTCAGGGCAGAGGCCTGCAGG - Exonic
1137270237 16:46898230-46898252 CGATGAGTGCAGAGGCCTCCTGG + Intronic
1138727200 16:59152757-59152779 CCAATAGGTCAGGGGCTACCTGG - Intergenic
1140617625 16:76685616-76685638 TTATTAGAGCAGAGGCTTACAGG + Intergenic
1141832134 16:86515756-86515778 CAGTTAGGGCAGAGGCTCCGGGG + Intergenic
1142126807 16:88414511-88414533 CCGTGAGGGCAGAGGCCCCCAGG + Intergenic
1143474753 17:7196204-7196226 ACATCAGGTCAGAGGCTTCCCGG - Exonic
1144764590 17:17725544-17725566 CCACCGGGTCAGAGGCTTCCCGG + Intronic
1144818294 17:18052344-18052366 CCACTGGTGCAGAGGCTCCCAGG - Intronic
1147327203 17:39675171-39675193 CCACTGGGGCACAGGCTCCCAGG + Intronic
1147518245 17:41142559-41142581 CCACTAGGGCAGAGATCTCCAGG - Intergenic
1148716591 17:49720250-49720272 CTATATGGGCAGAGGTTTCCTGG - Intronic
1150129424 17:62659169-62659191 TCATTAGGGAAGAGCCTTCATGG - Intronic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1152630366 17:81408269-81408291 CCATGCAGGCAGCGGCTTCCAGG - Intronic
1153576167 18:6524054-6524076 TGTTTAGGGGAGAGGCTTCCAGG + Intronic
1155026676 18:21946995-21947017 TCATTAGGGCAGAGCCCTCATGG - Intergenic
1155154557 18:23147818-23147840 CAAGTAGGGCAGCGTCTTCCTGG - Intronic
1158876054 18:61735587-61735609 CCCTTAGGGCAGAGGTGTTCAGG - Intergenic
1159544596 18:69823524-69823546 CCATTAGAGCAGAGGGTGTCAGG + Intronic
1159682374 18:71370795-71370817 CCAGCAAGGGAGAGGCTTCCAGG + Intergenic
1160018388 18:75161801-75161823 CCATCCGGGCACAGGCTTCCTGG + Intergenic
1160165043 18:76503784-76503806 ACATGAGCCCAGAGGCTTCCTGG + Intergenic
1160782089 19:882171-882193 CCAACAGGGCAGAGACTTCTGGG + Intronic
1160929856 19:1565572-1565594 CCATTAGGGTAGAGGATTCTGGG - Intronic
1161208554 19:3054799-3054821 CCTTCAGAACAGAGGCTTCCTGG - Intronic
1162605159 19:11701154-11701176 ACGTTAGGGCAGAGGATTCAGGG + Intergenic
1162680623 19:12338139-12338161 CCCTCAGGGCAGAGGATTCAGGG + Intergenic
1162835853 19:13317429-13317451 CCCTCAGGCCAGAGGCTTGCTGG - Intronic
1164715777 19:30389291-30389313 ACATTTGGGGAGAGGTTTCCTGG + Intronic
1164717706 19:30405537-30405559 CCATCAGACCAGAGTCTTCCAGG + Intronic
1165058134 19:33191842-33191864 ACATGAGAGCAGGGGCTTCCTGG - Intronic
1167414126 19:49361549-49361571 CCATCAGGGGAGGGGCTTGCCGG + Intronic
1167530723 19:50014636-50014658 CCATAAGGGAAGAGGCGTCCAGG + Intronic
925050776 2:813784-813806 CCCTCAGGGCAAGGGCTTCCAGG + Intergenic
925050784 2:813810-813832 CCCTTAGAGCAGGGGCTTCCAGG + Intergenic
925988184 2:9232580-9232602 CCATTAGATCATAAGCTTCCTGG + Intronic
932344314 2:70985607-70985629 CCCTAAGGGCCCAGGCTTCCAGG + Intronic
932548075 2:72736448-72736470 CCCTTAGAGCAGAGTCTCCCAGG + Intronic
932877750 2:75471319-75471341 CCATTAGGACTGTTGCTTCCTGG + Intronic
933613674 2:84462330-84462352 CCAGTAAGGCAGGGACTTCCTGG - Intergenic
934504369 2:94879584-94879606 CCAGGAGCCCAGAGGCTTCCTGG - Intergenic
934706419 2:96484736-96484758 TCATGAGGGCAGAGGCTTCATGG - Intergenic
940035504 2:149308756-149308778 CTATTCCAGCAGAGGCTTCCTGG + Intergenic
940953205 2:159700033-159700055 TCATAAGGGCAGAGCCTTCATGG - Intergenic
941442710 2:165557801-165557823 CCCTAAGGGCAGAGGTTTCTAGG - Intronic
942675471 2:178422043-178422065 CTATCAGGGTAGAGGCTTCTGGG + Intergenic
943223888 2:185144527-185144549 CTATGAGGGCAGGGGCTTCCTGG - Intergenic
944465744 2:199997784-199997806 ACATTTGGGCAGAGACTTCCGGG - Intronic
944783747 2:203046725-203046747 CCATGAGGGCAGAGCCTTCTTGG + Intronic
945384626 2:209182079-209182101 ACATTAGTGCAGAAGTTTCCAGG + Intergenic
1169182324 20:3580537-3580559 CCCTTAGGACAGAGGCTGGCTGG + Intronic
1169189714 20:3650479-3650501 CCAGGACGGCAGAGGCCTCCTGG + Exonic
1169296994 20:4408626-4408648 CCTTAGGGGCAGAGCCTTCCTGG + Intergenic
1170575935 20:17661504-17661526 CCAATGGGTCAGAGGCATCCAGG + Intronic
1170692943 20:18631425-18631447 ACAAGAGGACAGAGGCTTCCAGG - Intronic
1171520201 20:25770078-25770100 CCAAAAGGGCAGAGGCCCCCAGG + Intronic
1171556718 20:26086415-26086437 CCAAAAGGGCAGAGGCCCCCAGG - Intergenic
1174109859 20:48191461-48191483 CCACTAGGCCATTGGCTTCCAGG + Intergenic
1175742318 20:61428467-61428489 CCATTAAGCCAGATGCTTTCTGG - Intronic
1175771909 20:61629282-61629304 GCTTTTGGCCAGAGGCTTCCTGG - Intronic
1175953608 20:62596713-62596735 CCCTCAGGGGAGAGCCTTCCGGG + Intergenic
1176621667 21:9065591-9065613 CCAGGAGCCCAGAGGCTTCCTGG + Intergenic
1176654331 21:9576364-9576386 CCAAAAGGGCAGAGGCCCCCAGG + Intergenic
1176718459 21:10374167-10374189 TCCTTAGGAAAGAGGCTTCCTGG + Intergenic
1178437641 21:32573902-32573924 TCATTAGCCCTGAGGCTTCCAGG + Intergenic
1180299687 22:11027072-11027094 TCCTTAGGAAAGAGGCTTCCTGG + Intergenic
1182782510 22:32879577-32879599 CCATGAGGGCAGAGTTTTCATGG - Intronic
1183189196 22:36310818-36310840 TCATCAGTGCAGAAGCTTCCAGG - Intronic
1184878244 22:47289007-47289029 CCATCAGAGCAGAGTCCTCCCGG - Intergenic
1185088640 22:48754002-48754024 TCAGGAGGGCAGAGGCTTGCGGG - Intronic
1185181448 22:49365759-49365781 ACATTCGGGCAGAGATTTCCAGG + Intergenic
949548016 3:5089331-5089353 CCAACAGGGCAGAGCCTACCTGG + Intergenic
950493082 3:13317991-13318013 CCAGGAGCGCAGAGCCTTCCGGG + Intronic
950500799 3:13362293-13362315 TCATGAGGGCAGAAGCTTCACGG - Intronic
950719129 3:14870174-14870196 GCCCTAGGGCAGAGCCTTCCAGG + Intronic
952184873 3:30957570-30957592 CCTCTCGGGCAGAGGCTTCCAGG + Intergenic
954381510 3:50221424-50221446 CCAACAGGGCACAGGATTCCTGG - Intergenic
954502503 3:51031771-51031793 CCATGAGGGCAGAGCCCTCGTGG - Intronic
954655980 3:52194608-52194630 CCTTCAGGGCAGAGGCCTGCAGG - Intergenic
955564736 3:60231917-60231939 ACCATAGGGCTGAGGCTTCCAGG + Intronic
956644971 3:71446435-71446457 TCCTTAGGGCAGAGGCTCCAGGG - Intronic
956837047 3:73103989-73104011 CTGTCAGGGAAGAGGCTTCCCGG - Intergenic
959215222 3:103443326-103443348 CCCTTAGTGCTAAGGCTTCCAGG + Intergenic
960139685 3:114140076-114140098 GCAACAGGGCAGAGGCTCCCAGG + Intronic
962920590 3:139946831-139946853 CCATTATTGCTCAGGCTTCCTGG + Intronic
964655943 3:159066273-159066295 TCATGAGGGCAGAGCCTTCATGG - Intronic
969110550 4:4841486-4841508 CCTTTAGGGCAGAGGCTCCGTGG - Intergenic
969373828 4:6750218-6750240 TCATCACGGCAGAGGCTGCCGGG - Intergenic
972926289 4:44013260-44013282 TCATGAGGGCAGAGCCTTCATGG - Intergenic
976143084 4:82013349-82013371 CCATGAGAGCAGAGCCTTCCTGG - Intronic
977378375 4:96237748-96237770 CCACAAGGGCAGAGCTTTCCAGG + Intergenic
977439771 4:97049846-97049868 TCATTAGGGCAGAGCCCTCATGG - Intergenic
980515678 4:133856275-133856297 CAATTAGGGAAGAGACATCCAGG - Intergenic
981003841 4:139854681-139854703 CCCTTAGGACAGAGGTCTCCTGG - Intronic
984640844 4:182162833-182162855 CCATGAGAGCAGAGCCTTCGCGG + Intronic
985231155 4:187819719-187819741 TCATGAGGGCAGAGGCCTCATGG - Intergenic
986067154 5:4245797-4245819 GCTTTAGGGATGAGGCTTCCTGG - Intergenic
986427726 5:7651377-7651399 CCCTTTGGGATGAGGCTTCCTGG - Intronic
987207825 5:15645417-15645439 CAAGCAGGGAAGAGGCTTCCAGG - Intronic
988558805 5:32261654-32261676 CCAAGAGGGCAGAGGTTTTCAGG + Intronic
989621430 5:43388187-43388209 CCATTAGGCCCCAGGCTCCCTGG - Intronic
990867009 5:60390801-60390823 CTCTGAGGGCAGAGGGTTCCTGG - Intronic
991223282 5:64240735-64240757 ACCTCAGGGCAGAGCCTTCCAGG - Intronic
993699668 5:91103473-91103495 CCATCAGGGCAGAGCCATCAGGG + Intronic
994124062 5:96150454-96150476 CTAGTAGGGAGGAGGCTTCCAGG + Intergenic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
996590416 5:125140550-125140572 CCATGAGGACAGAGGCCTCATGG + Intergenic
996875727 5:128238537-128238559 ACTTTAGGGCAATGGCTTCCTGG + Intergenic
997454167 5:134005113-134005135 CCATTAGCGCAGGGACCTCCGGG - Exonic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
999100474 5:149019943-149019965 CCCTGTGAGCAGAGGCTTCCAGG - Intronic
999346617 5:150827746-150827768 GCATTTGGGCAGAGTCTTCAGGG + Intergenic
1000979573 5:167802136-167802158 TCATGAGGGCAGAGCCTTCATGG + Intronic
1001271383 5:170314804-170314826 CCACCAGGGCAGAGGTTCCCTGG + Intergenic
1001365431 5:171133645-171133667 CCATGTGGGCATAGGCTACCCGG + Intronic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1003369445 6:5510310-5510332 CCCTTAGGGGAGATGCTGCCTGG + Intronic
1004756978 6:18620950-18620972 TGATGAGGGCAGAGGCTTCATGG + Intergenic
1005812520 6:29528403-29528425 CCAAGAGGGCAGAGGTTACCTGG - Intergenic
1006995557 6:38256731-38256753 CCAGTGGGGCAGAGCCTGCCTGG - Intronic
1008549168 6:52611167-52611189 TCATAAGGGCAGAGTCTTCATGG - Intergenic
1008888538 6:56458406-56458428 CAATGAGGCCAGAGGCATCCTGG - Exonic
1010012858 6:71069290-71069312 CCATCAGGGCAGAGCCCTCATGG + Intergenic
1011038372 6:83002349-83002371 CCATGAGGGCAGAGCCATCATGG - Intronic
1013174937 6:107668942-107668964 CCAGCAGGGCTGGGGCTTCCAGG + Intergenic
1013607231 6:111761660-111761682 CCAGAAGGGCAGAGCCTTCCGGG + Intronic
1015182819 6:130379069-130379091 CCATGAGGGCAGAGGCCTCGTGG + Intronic
1015290906 6:131537599-131537621 TCATAAGGGCAGAGCCTTCAAGG + Intergenic
1017681890 6:156872690-156872712 TCAGTAGGACAGAGCCTTCCAGG + Intronic
1018407028 6:163496751-163496773 ACATAAGGGCAGAGTATTCCAGG - Intronic
1018795392 6:167181393-167181415 TCATTAGCCCGGAGGCTTCCAGG - Intronic
1018820931 6:167373670-167373692 TCATTAGCCCGGAGGCTTCCAGG + Intronic
1019103965 6:169653882-169653904 CCATCACGGCACAGGCTTCCTGG - Intronic
1020188097 7:5974119-5974141 CCATTGGGGGAGAGGGTCCCGGG - Intronic
1020294821 7:6750650-6750672 CCATTGGGGGAGAGGGTCCCGGG + Intergenic
1021372562 7:19867635-19867657 CCACAAGGGCAGAAGCTGCCCGG - Intergenic
1021412364 7:20342847-20342869 CAAGTACGGCAGAGCCTTCCAGG + Intronic
1021771431 7:24005757-24005779 CCATGAGGGCAGAGACCTCCTGG + Intergenic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1022410201 7:30134554-30134576 GCATTTGGGCAAACGCTTCCTGG + Intergenic
1023614505 7:42006221-42006243 CCAATGGGGCACAGGCTGCCTGG + Intronic
1023849824 7:44144457-44144479 CCCTTGGGGCAGAGGCTTGGGGG + Exonic
1024821580 7:53337084-53337106 CAAGCAGGGCAGGGGCTTCCAGG - Intergenic
1025280695 7:57625032-57625054 CCAAAAGGGCAGAGGCCCCCAGG + Intergenic
1025304035 7:57840475-57840497 CCAAAAGGGCAGAGGCCCCCAGG - Intergenic
1026237486 7:68540183-68540205 CCCTTAGAGAAGAGCCTTCCTGG + Intergenic
1026863214 7:73807321-73807343 CCCTTCTGGCTGAGGCTTCCTGG - Intronic
1029042200 7:97588188-97588210 TCATGAGAGCAGAGGCTTCTGGG - Intergenic
1029885277 7:103863334-103863356 AGATTAGGTCAGATGCTTCCAGG - Intronic
1032020558 7:128405390-128405412 CCACGAGGGCAGAGGGTCCCCGG - Intronic
1032196780 7:129793996-129794018 CCAGTTGGGCAAGGGCTTCCAGG - Intergenic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1033818900 7:145109604-145109626 TCATGAGGGCAGAGCCTTCATGG - Intergenic
1034746817 7:153530238-153530260 CTAGAAGCGCAGAGGCTTCCAGG + Intergenic
1035521066 8:275259-275281 CCTGTGGGGCAGAGGCTTGCAGG + Intergenic
1037516280 8:19635153-19635175 CCATCAGGGCAGAGGGGACCAGG + Intronic
1037812301 8:22094375-22094397 CCATGCGGGCAGGGGCTCCCTGG + Intronic
1038260361 8:25987787-25987809 CCCTGAGGGCAGGGGCTTCTAGG - Intronic
1038841421 8:31187986-31188008 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1041423548 8:57695376-57695398 CCATGGGGGTAGAGGCTCCCTGG - Intergenic
1042474696 8:69233893-69233915 CCATGAGGGCAGAGACCTCAGGG - Intergenic
1044014691 8:87036824-87036846 GCAAGAGGGCAGAGGCCTCCAGG - Intronic
1044760391 8:95511497-95511519 TCATGAGGGCAGAGGCCTCGTGG - Intergenic
1046803558 8:118455201-118455223 CCATTGTGTCAGAGGCTACCAGG - Intronic
1047028544 8:120851136-120851158 TCATGAGGGCAGAGCCTTCATGG + Intergenic
1047498044 8:125422467-125422489 CCATTAGGGCAGGGAATCCCAGG - Intergenic
1049373157 8:142277254-142277276 GCACTAGGCCAGAGGCCTCCAGG + Intronic
1049437985 8:142596416-142596438 CCCCTAGGGCAGGGGCTACCAGG - Intergenic
1050632922 9:7579733-7579755 ACATTAGAGGAGATGCTTCCTGG - Intergenic
1050769282 9:9176611-9176633 TCATGAGGGCAGAGGCCTCATGG - Intronic
1052032686 9:23646155-23646177 CCTGTAGGGCAGTGGCTTTCAGG - Intergenic
1053008081 9:34617287-34617309 CCATGAGGGCAGGGACTTTCTGG + Intronic
1053051358 9:34963445-34963467 CCCTTTGGGCACATGCTTCCAGG + Intronic
1053289532 9:36870931-36870953 CCCTCAGGGCAGGGGCTGCCTGG + Intronic
1053424204 9:38000442-38000464 CCATGAGTGCAGGGCCTTCCAGG - Intronic
1054974008 9:71121383-71121405 CCATTAGGGCAGAGGCTTCCTGG + Exonic
1055497713 9:76872116-76872138 CCATGAGGGCACAGGGTTCCAGG - Intronic
1058163258 9:101593314-101593336 CCACTAGGGAAAAGGCTTCCTGG + Exonic
1058729973 9:107840437-107840459 CCATTTGGGAAGAGGCTTCATGG + Intergenic
1058941497 9:109816798-109816820 CCATGAGGGCAGAGGAGTCATGG + Intronic
1059081566 9:111255674-111255696 TCATGAGGGCAGAGTCTTCATGG + Intergenic
1060274351 9:122171211-122171233 CCGTCAGGGCAGAAGCCTCCAGG + Intronic
1060939201 9:127534054-127534076 CCATGAGGGGAGAGGCTTCCTGG + Intronic
1061175644 9:128994864-128994886 TGATTAGGGCACAGGTTTCCAGG - Exonic
1061909790 9:133716522-133716544 CCCCTGGGGCAGAGCCTTCCGGG + Intronic
1061909811 9:133716579-133716601 CCCCTGGGGCAGAGCCTTCCAGG + Intronic
1061921581 9:133785423-133785445 CCATGATGCCAGAGGATTCCTGG - Intronic
1062216286 9:135391394-135391416 CCATGTGGCCTGAGGCTTCCCGG - Intergenic
1203632052 Un_KI270750v1:79822-79844 CCAAAAGGGCAGAGGCCCCCAGG + Intergenic
1186179286 X:6957309-6957331 TCATAAGGGCAGAGCCTTCATGG - Intergenic
1187827075 X:23342422-23342444 CCCTTAGGGCAGATGCTCTCAGG - Intronic
1188424689 X:30032691-30032713 TCATGAGGGCAGAGCCTTCATGG + Intergenic
1189647735 X:43152298-43152320 CCCTGAGGGCAGAGTCTTACTGG + Intergenic
1194332642 X:92601874-92601896 CCACTGAGGCACAGGCTTCCAGG + Intronic
1194379533 X:93176574-93176596 CCATCTGGGGAGAGGCTTCAAGG + Intergenic
1195544909 X:106103315-106103337 CTATTAGGCCAGATGCTTCAGGG - Intergenic
1197349125 X:125360484-125360506 TCATCAGGGCAGAGGCCTCATGG - Intergenic
1200641339 Y:5720928-5720950 CCACTGAGGCACAGGCTTCCAGG + Intronic
1201158189 Y:11151044-11151066 CCAGGAGCCCAGAGGCTTCCTGG + Intergenic
1202336300 Y:23814209-23814231 CCATTAGGGGGCAGGCTCCCAGG + Intergenic
1202534466 Y:25855858-25855880 CCATTAGGGGGCAGGCTCCCAGG - Intergenic