ID: 1054982462

View in Genome Browser
Species Human (GRCh38)
Location 9:71222757-71222779
Sequence AGGCAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054982452_1054982462 26 Left 1054982452 9:71222708-71222730 CCCCAGCAGCAGCCATACGGTGT No data
Right 1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG No data
1054982453_1054982462 25 Left 1054982453 9:71222709-71222731 CCCAGCAGCAGCCATACGGTGTG No data
Right 1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG No data
1054982456_1054982462 14 Left 1054982456 9:71222720-71222742 CCATACGGTGTGGAAAGAGAATC No data
Right 1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG No data
1054982454_1054982462 24 Left 1054982454 9:71222710-71222732 CCAGCAGCAGCCATACGGTGTGG No data
Right 1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG No data
1054982451_1054982462 27 Left 1054982451 9:71222707-71222729 CCCCCAGCAGCAGCCATACGGTG No data
Right 1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054982462 Original CRISPR AGGCAGAGCACAGTGATTGT GGG Intronic