ID: 1054985545

View in Genome Browser
Species Human (GRCh38)
Location 9:71258170-71258192
Sequence GCCAATGTGTGCAAAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054985545 Original CRISPR GCCAATGTGTGCAAAGAGCC TGG (reversed) Intronic
900437152 1:2636379-2636401 GAGAATGTGTGCACAGTGCCAGG + Intronic
900484458 1:2914849-2914871 GCCACTGTGTACAAAGGGCTGGG - Intergenic
901004204 1:6163993-6164015 GCCTATGTGTGCCAGGAGGCAGG + Intronic
901644303 1:10708504-10708526 CCTTATGTGTGCAAAGAGCCTGG + Intronic
902375771 1:16029314-16029336 CCCCAGGTGTGCACAGAGCCAGG + Intronic
903674112 1:25053750-25053772 GCCAAGCTTTGCCAAGAGCCAGG + Intergenic
904028820 1:27521376-27521398 GCCAGTGTGGGCCCAGAGCCAGG + Intergenic
907712894 1:56900792-56900814 GCAAATCTCTGCACAGAGCCTGG - Intronic
907736419 1:57116960-57116982 GACAATGTTTGCAGAGTGCCGGG - Intronic
908252395 1:62275289-62275311 GCCAATGTCTGCAAGGAAACAGG + Intronic
909957589 1:81800016-81800038 GGCAATGTCAGCAAACAGCCAGG - Intronic
910592001 1:88935806-88935828 ACTAATGTATGCAAAAAGCCTGG - Exonic
912577356 1:110685607-110685629 GCCAAGGTGGGCAAATTGCCTGG - Intergenic
913001265 1:114582698-114582720 GCCTTTGTCTGCCAAGAGCCTGG + Intergenic
916498496 1:165366514-165366536 GCAAATGTGTCCACAGAGTCTGG - Intergenic
916607078 1:166353681-166353703 CCCAATGTGTGGCATGAGCCTGG + Intergenic
919737326 1:200960867-200960889 GATAATGTGTGCAAAGTCCCTGG - Intergenic
919774575 1:201185696-201185718 GCCACTGTGCGGAGAGAGCCAGG + Intergenic
919845709 1:201640866-201640888 CCCACTGTGTGCACAGAGCTGGG + Intronic
920203421 1:204274865-204274887 GCCAATGCGTGGACAGACCCTGG + Intronic
920448760 1:206040937-206040959 GAAAATGTGTGCAAAGATCCAGG - Intronic
923622698 1:235591216-235591238 GCCAAGGTGGGTAATGAGCCAGG - Intronic
1066151944 10:32630956-32630978 GAGATTGTGTGCCAAGAGCCAGG - Intronic
1068407081 10:56604250-56604272 GACAATATTTGCAAAGAGCTTGG + Intergenic
1069895946 10:71680131-71680153 GTCAAAGTGTTCAAAGAGGCTGG - Intronic
1070836448 10:79450013-79450035 TCCAAGGTGTGGAAAGTGCCTGG + Intergenic
1071432240 10:85615250-85615272 GCCAATCTTTGCACTGAGCCAGG - Intronic
1072744463 10:97930050-97930072 GCTGATGTGGGCAAAGTGCCTGG - Intronic
1072830068 10:98648145-98648167 CCCAAAGTGTGCAAAGAGTTAGG - Intronic
1073442301 10:103559352-103559374 GCCACTGTGTGCCAGGCGCCAGG - Intronic
1073654060 10:105393314-105393336 GCCAATGACAGCAGAGAGCCTGG - Intergenic
1075743571 10:124710752-124710774 GCTAATGTGTGTAAAGCGCCTGG - Intronic
1075838525 10:125477140-125477162 GCTAATGTGTGGAAAGATTCTGG - Intergenic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1080793602 11:35542876-35542898 GCCAAGGTTTGGAAAGAACCAGG + Intergenic
1082987835 11:59183335-59183357 GACAATGTATGGAAAGTGCCTGG - Intronic
1083671081 11:64300220-64300242 GCCAATGTGTGTGCAGAGGCTGG - Intergenic
1087211760 11:95452139-95452161 GCCACTGTATGGAAGGAGCCTGG + Intergenic
1087900100 11:103630873-103630895 AACAATGTGTGCAAAGACCAGGG + Intergenic
1088183085 11:107134282-107134304 GACAAGGTATGTAAAGAGCCTGG - Intergenic
1088592656 11:111416635-111416657 GCCAATGTGAGCAGAGAGCACGG + Intronic
1089408564 11:118219559-118219581 GGCACTGTCTGCAAAGAGGCAGG - Intronic
1090886079 11:130878062-130878084 GCACATGTGTGCACAGGGCCAGG + Exonic
1091368301 11:135039598-135039620 GGAAAGGTGTGCAAGGAGCCTGG - Intergenic
1092992652 12:13917941-13917963 CCCAATATGTCCAAAGAGCCTGG - Intronic
1094065403 12:26356462-26356484 GCCATTATTTGAAAAGAGCCAGG - Intronic
1094777390 12:33746151-33746173 GCCAATGAGTGAAAGCAGCCAGG + Intergenic
1096685528 12:53286064-53286086 GCCACTGTGGCCAAGGAGCCTGG + Exonic
1096740128 12:53687148-53687170 GCAAATGTGTGCAAAGCACCTGG + Intergenic
1097377916 12:58860550-58860572 GCCAATCTGTGAAAGCAGCCAGG - Intergenic
1101379455 12:104201817-104201839 GCCCATTTCTGCAAACAGCCAGG - Intergenic
1102195653 12:111023482-111023504 GACAATGCATGCGAAGAGCCTGG - Intergenic
1103706125 12:122873841-122873863 GCAGATGTGTGCAAAGTGCTTGG - Intronic
1103970884 12:124670828-124670850 CCCCATCTGTACAAAGAGCCGGG + Intergenic
1104076326 12:125392978-125393000 GCAAATGTGGGCACAGAGGCAGG - Intronic
1104592878 12:130098754-130098776 GCCAAGGTGTGAAGAGGGCCTGG + Intergenic
1104969521 12:132524981-132525003 GTGAGTGTGTGCAAAGCGCCCGG + Intronic
1105210739 13:18255394-18255416 GGCAACGTGTGAAAAGAGCCTGG + Intergenic
1107453986 13:40537437-40537459 ACTAGTGTGTGCAAAGAGGCAGG - Intergenic
1110734965 13:78925826-78925848 GATAATGTATGCAAAGTGCCTGG - Intergenic
1112576643 13:100642224-100642246 GCCATGCTGTGCAAAGAGCAAGG - Exonic
1113572691 13:111370105-111370127 GCCCATGTGTCCACAGGGCCTGG + Intergenic
1115735178 14:36320317-36320339 GCCGAGGTGTGGAAGGAGCCCGG - Intronic
1115964483 14:38872195-38872217 TCCAATATGTCAAAAGAGCCAGG - Intergenic
1119617598 14:76109073-76109095 GCCAGTGTGTGCAGAGATCGAGG + Intergenic
1119964934 14:78903991-78904013 GACAGTGTGTGTAAAGTGCCTGG - Intronic
1125401641 15:39310701-39310723 GCCAGTCTGTGCACAGAGCATGG - Intergenic
1127351288 15:58155234-58155256 GCCAATGTGTAGGAAGAGGCAGG - Intronic
1128576102 15:68776171-68776193 GCCACTGTGTTCAAAGTACCAGG - Intergenic
1128937890 15:71763677-71763699 GCCAAGGTGAGCAAATCGCCTGG - Intronic
1129163982 15:73765052-73765074 CCCACAGTGTGCAAACAGCCTGG + Intergenic
1133056916 16:3149994-3150016 GATAATGTGTGTAAAGCGCCTGG + Intergenic
1133515171 16:6501800-6501822 CCCAGTGTCAGCAAAGAGCCTGG - Intronic
1134331363 16:13254161-13254183 GCTAATGTATGCAAATTGCCTGG - Intergenic
1136545395 16:30951498-30951520 TCAAATGTTTGCAAAGGGCCAGG + Intronic
1137269581 16:46894475-46894497 GCCTCTGTGTGCAAAGGGACGGG - Intronic
1137618674 16:49861473-49861495 AACAGTGTGTGCAAAGGGCCTGG + Intergenic
1138538880 16:57676185-57676207 GCCAGTATCTGCAAAGGGCCAGG - Exonic
1139099155 16:63744465-63744487 GCCAATATGTGCATAGACTCTGG + Intergenic
1140908072 16:79427253-79427275 GCCCATGTTTGGAAAGAGCCTGG + Intergenic
1142619794 17:1157721-1157743 GCCAATGCGTGCGGACAGCCTGG + Intronic
1149322417 17:55494978-55495000 GGCAATGTATGCAAAGCGCTTGG + Intergenic
1150134546 17:62688762-62688784 TGCAATGTGAGCAAAGAGGCTGG - Intronic
1151902391 17:77025147-77025169 GACAATGTGGGCAAAGTGCTTGG - Intergenic
1151947278 17:77326516-77326538 GGCAATGTGTTCAAAGGCCCTGG + Intronic
1152431412 17:80250113-80250135 GCCAGTGTTTGCAGAGAGGCAGG + Intronic
1155357057 18:24963077-24963099 ACCATTGTGTGCCCAGAGCCTGG + Intergenic
1157523435 18:48361080-48361102 GCCAAGGTCTGCAATGAGCATGG + Intronic
1157703227 18:49778860-49778882 GGGAATGTCTGCAAAGAGTCCGG + Intergenic
1159193241 18:65076431-65076453 GCCAATGTTTACAAAGATTCAGG - Intergenic
1160237916 18:77100435-77100457 GACAATGTCTGCAAAGTCCCTGG + Intronic
1161261118 19:3338430-3338452 TCCCATGTGTGCAATGGGCCTGG - Intergenic
1161479928 19:4505368-4505390 GGCAGTGTGTGCAAAGGCCCTGG - Intronic
1161868852 19:6854909-6854931 ACCAGTGTGTGCAAAGGCCCTGG + Intronic
1162832735 19:13297132-13297154 GGTAATGTATGCAAAGGGCCTGG - Intronic
1165486086 19:36097058-36097080 GCCACTGTGGGCAAAGCGGCTGG + Exonic
1166275283 19:41749331-41749353 TCCCATGTATGCATAGAGCCTGG - Intronic
1166280307 19:41788128-41788150 TCCCATGTATGCATAGAGCCTGG - Intergenic
1166738401 19:45099570-45099592 GTCACAGTGTGCAAAGGGCCTGG - Intronic
926443639 2:12918068-12918090 GCCAATGTCTCAAAAGAGACAGG + Intergenic
927051291 2:19331888-19331910 GACAATGTGTGCAATTAACCTGG - Intergenic
929943111 2:46349734-46349756 GCGAATGTGTGGCAGGAGCCTGG - Intronic
931370880 2:61661425-61661447 TCCAAAGTGTGCAAAGACCTGGG - Intergenic
933998654 2:87688256-87688278 GCAAATGTGGGAAAGGAGCCTGG - Intergenic
935025029 2:99268644-99268666 GGGAATGTCTGCAAAGAGCCTGG + Intronic
935178321 2:100668672-100668694 CCCCATGTCTGCAAAGAGACAGG - Intergenic
936295195 2:111262614-111262636 GCAAATGTGGGAAAGGAGCCTGG + Intergenic
937041064 2:118821108-118821130 GATAATGTATGCAAATAGCCAGG + Intergenic
937179069 2:119973514-119973536 GCCCATGTGTGCTATGATCCAGG - Intronic
939013707 2:136877075-136877097 GCCCGTATGTGCATAGAGCCTGG + Intronic
939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG + Intergenic
939598594 2:144159894-144159916 GCCAATGTGTACACAGTGCGGGG + Intronic
940567644 2:155388107-155388129 GCCAATGTTTGAAAAGTGCAAGG + Intergenic
944683623 2:202098543-202098565 GCCAAGATGAGCAAAGAGTCAGG - Intronic
945357381 2:208856556-208856578 ACCAATGGGTGCAATTAGCCTGG + Intergenic
946252085 2:218419862-218419884 GCCAGTGTGTCCTCAGAGCCTGG - Intronic
946669985 2:222092213-222092235 GCCATCATGTGCATAGAGCCAGG + Intergenic
948630018 2:239296335-239296357 GCCACTGTCTGCAGAGACCCTGG - Intronic
1169320893 20:4632436-4632458 GCCAGTTTGTGAAAACAGCCAGG + Intergenic
1170413982 20:16120742-16120764 GCAACTGTGTGCAAACAGCGTGG - Intergenic
1171291881 20:23987083-23987105 GGCAATGTGTGAAAAGAGCCTGG + Intronic
1172231255 20:33337824-33337846 CCCAGTGGGTGCAAAGAGGCAGG + Intergenic
1172766172 20:37352221-37352243 GCCAATGTGTGCCAAGTGCTTGG + Intronic
1174425369 20:50428399-50428421 GACAATGTGTGTAAAGTGCCAGG - Intergenic
1174858464 20:54068526-54068548 GACAATGTGTGTGAAGTGCCTGG - Intronic
1175219353 20:57408097-57408119 GCCATGGTGTGCAAGGAACCTGG - Exonic
1176895426 21:14372765-14372787 GCCAATGTTTGCAAAGGTCTCGG + Exonic
1178181793 21:30170061-30170083 TAGAATGTGTGCAAAGAACCTGG + Intergenic
1178903032 21:36612975-36612997 GCCAAGGTCTGCAAAATGCCCGG - Intergenic
1179981707 21:44899342-44899364 GGCAATGTGTGCATAGACTCGGG + Intronic
1180685640 22:17664422-17664444 GCCAGTCTGTGAAAGGAGCCGGG - Intronic
1180765515 22:18344023-18344045 GGCAACGTGTGAAAAGAGCCTGG - Intergenic
1180780801 22:18518369-18518391 GGCAACGTGTGAAAAGAGCCTGG + Intergenic
1180813514 22:18775676-18775698 GGCAACGTGTGAAAAGAGCCTGG + Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181199698 22:21210006-21210028 GGCAACGTGTGAAAAGAGCCTGG + Intronic
1181400064 22:22645852-22645874 GGCAACGTGTGAAAAGAGCCTGG - Intronic
1181617984 22:24068055-24068077 TGCAATCTGTGCAAAAAGCCTGG - Intronic
1181649300 22:24249938-24249960 GGCAACGTGTGAAAAGAGCCTGG + Intergenic
1181702038 22:24626950-24626972 GGCAACGTGTGAAAAGAGCCTGG - Intronic
1182642644 22:31780718-31780740 GCTAATGAGTGCACAGATCCAGG - Intronic
1183921102 22:41169386-41169408 AACGATGTGAGCAAAGAGCCTGG + Intronic
1184582356 22:45426212-45426234 GGCAGTGGGAGCAAAGAGCCTGG - Intronic
1203227137 22_KI270731v1_random:84913-84935 GGCAACGTGTGAAAAGAGCCTGG - Intergenic
1203263615 22_KI270734v1_random:1358-1380 GGCAACGTGTGAAAAGAGCCTGG + Intergenic
950611735 3:14131391-14131413 GGCACTGTGTGTAAAGAACCTGG + Intronic
950684919 3:14609689-14609711 GCCAATGTGAGCAAACTGCTTGG + Intergenic
953204736 3:40815497-40815519 GCCAATCTGTTCCAAGAGCCTGG + Intergenic
953922247 3:46960219-46960241 GCCTCTCTGTGCACAGAGCCTGG - Intronic
955337072 3:58095602-58095624 GCCAATGTGGGAAGAGAGCAGGG - Intronic
959778483 3:110199716-110199738 GCAAATGCTTGCAAAGAGGCAGG + Intergenic
959897055 3:111617173-111617195 GCCATTTGGTGCAAACAGCCTGG + Intronic
960541754 3:118869503-118869525 GCAAATGTGAGCATAGAGCCTGG - Intergenic
963254671 3:143133044-143133066 GCTAATTTGTGCAAAGAGAAAGG - Intergenic
966234386 3:177684980-177685002 GCGAATGTAAGCAAAGAACCTGG - Intergenic
969011159 4:4063804-4063826 GCCAACGTGTGAAAGGAGCCAGG - Intergenic
969288643 4:6224266-6224288 GCTAATGTTTGCAAAGGGCTTGG - Intergenic
970639893 4:18052156-18052178 GCCAATGGGAGCCAAGACCCAGG - Intergenic
974377165 4:61093714-61093736 GCGAATGTGTACAAAGAGTTCGG - Intergenic
977214133 4:94258809-94258831 GCTAATGTTTTTAAAGAGCCAGG - Intronic
982087638 4:151852510-151852532 GAAAATGTGTCCAAACAGCCAGG - Intergenic
984951464 4:185010913-185010935 GCCAATGCATGCCAACAGCCAGG + Intergenic
985136237 4:186788632-186788654 GGCCATGTGTGCCAAGAGCCTGG - Intergenic
985248857 4:188002961-188002983 GGCTATGTGTGCTATGAGCCTGG + Exonic
986419185 5:7560233-7560255 GTGAATGTGTGGAAAGAGACTGG + Intronic
987276253 5:16365781-16365803 AACAATGTGTGCAAAGACCTTGG - Intergenic
988692994 5:33591563-33591585 GACAATGGGTACACAGAGCCAGG - Intronic
988962368 5:36383018-36383040 GCCAAAGGTTGAAAAGAGCCTGG - Intergenic
989525946 5:42454116-42454138 GCGAATGTCTGCAAAGAGACCGG + Intronic
992175743 5:74147106-74147128 ACAAATATGTTCAAAGAGCCAGG - Intergenic
996839247 5:127828498-127828520 CACTATGTGTGCACAGAGCCTGG - Intergenic
998390059 5:141781600-141781622 GCTCATGTGTGCAAAGGGGCTGG - Intergenic
1000953611 5:167515475-167515497 GCCAATGGGTTCCAATAGCCAGG + Intronic
1001890934 5:175337913-175337935 GCTAATGGTTGAAAAGAGCCTGG + Intergenic
1002892405 6:1346926-1346948 GCTAATGAGTGCAAGGAGCTGGG - Intergenic
1004445951 6:15698729-15698751 GCCAGTGTGTGCAAAGAGATAGG + Intergenic
1007126156 6:39427252-39427274 GCAAATGTGTGGAAGGGGCCCGG + Intronic
1007262979 6:40576768-40576790 GCCACTGTCTGCTTAGAGCCAGG - Intronic
1007757318 6:44108409-44108431 GCTGATGTCTGCAAAGAGGCAGG - Intergenic
1008603593 6:53119075-53119097 ACCAATGGGTCCAAACAGCCTGG + Intergenic
1008671286 6:53771898-53771920 GCCAATGTGTGCAAATCACACGG + Intergenic
1010394620 6:75376393-75376415 GCTAATGTATACAAAGTGCCTGG + Intronic
1015627557 6:135196498-135196520 ACCATTTTGTGGAAAGAGCCAGG - Intronic
1017113368 6:150953220-150953242 GCCAATATTGGCCAAGAGCCTGG - Intronic
1017166011 6:151409095-151409117 GCCAAAGGGTGCAGAGAGACTGG + Intronic
1017185619 6:151597845-151597867 AGCATTGTCTGCAAAGAGCCAGG - Intronic
1017519394 6:155188088-155188110 GATAATGTGTGCAAAGTTCCCGG + Intronic
1019191597 6:170254385-170254407 CCCAGTGTGTGCCAAGAACCAGG + Intergenic
1019599222 7:1873201-1873223 GTAAATGTGTGCAGGGAGCCTGG + Intronic
1023125212 7:36948403-36948425 GACAATGTATGCCAAGTGCCTGG - Intronic
1025177439 7:56809250-56809272 GCCAATGTGAGGAATGAGCTGGG + Intergenic
1026730763 7:72910018-72910040 GCCCATGTGTGAAAACAACCAGG - Intronic
1027113331 7:75458154-75458176 GCCCATGTGTGAAAACAACCAGG + Intronic
1027285581 7:76642749-76642771 GCCCATGTGTGAAAACAACCAGG + Intergenic
1028849585 7:95522652-95522674 GCCTTTGTGTGGAAAGAGACTGG - Intronic
1029218514 7:98969766-98969788 GCCACTGTGTGGAAAGAGATGGG + Intronic
1035907799 8:3532337-3532359 GAAAATGTGTGCCAATAGCCAGG - Intronic
1036501379 8:9317715-9317737 GAAAATGTTTGCAAAGGGCCCGG - Intergenic
1039733107 8:40300918-40300940 GTCAAAGTGTGCAAATAGCTGGG - Intergenic
1043426630 8:80154376-80154398 GCCAATGTGCGCAAAGCCCAAGG + Intronic
1044013404 8:87022212-87022234 GGGAATGTCTGCAAAGAGGCAGG + Intronic
1045347627 8:101308487-101308509 GTCAATTTCTACAAAGAGCCTGG + Intergenic
1046930065 8:119833055-119833077 GACAAAGTTTGCGAAGAGCCAGG + Intergenic
1048859280 8:138711872-138711894 GGCATTCTGTGCTAAGAGCCAGG + Intronic
1049759151 8:144324081-144324103 GTGGGTGTGTGCAAAGAGCCTGG + Intronic
1050801118 9:9615728-9615750 GATAATGTTTGTAAAGAGCCTGG - Intronic
1052277580 9:26694560-26694582 GCCAGTTTGTGCAAACAACCAGG - Intergenic
1054985545 9:71258170-71258192 GCCAATGTGTGCAAAGAGCCTGG - Intronic
1056126186 9:83538196-83538218 GCCACTGTGTGCCGAGAGGCAGG - Exonic
1058917267 9:109579632-109579654 GACAATATGTGCAAAGTGCCAGG - Intergenic
1059412508 9:114141539-114141561 CCTAATGTGTGCATAGAGCTTGG + Intergenic
1060392187 9:123287184-123287206 GATAATATGTGCAAAGTGCCTGG - Intergenic
1187227973 X:17392240-17392262 GCCACCGTATGGAAAGAGCCTGG + Intronic
1195420249 X:104667452-104667474 GACAATGTATGTAAAGTGCCTGG - Intronic
1195871537 X:109491511-109491533 GCCAAAGAATGGAAAGAGCCTGG - Intergenic
1197669865 X:129264516-129264538 GCCAATGGGTGGAAGGAACCAGG - Intergenic