ID: 1054990652

View in Genome Browser
Species Human (GRCh38)
Location 9:71321764-71321786
Sequence AAGTATTTGCTGAATGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1029
Summary {0: 1, 1: 1, 2: 15, 3: 131, 4: 881}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054990652_1054990654 12 Left 1054990652 9:71321764-71321786 CCTTATTCATTCAGCAAATACTT 0: 1
1: 1
2: 15
3: 131
4: 881
Right 1054990654 9:71321799-71321821 GTCCATGTACATTAATTTGGCGG No data
1054990652_1054990653 9 Left 1054990652 9:71321764-71321786 CCTTATTCATTCAGCAAATACTT 0: 1
1: 1
2: 15
3: 131
4: 881
Right 1054990653 9:71321796-71321818 TTAGTCCATGTACATTAATTTGG No data
1054990652_1054990655 13 Left 1054990652 9:71321764-71321786 CCTTATTCATTCAGCAAATACTT 0: 1
1: 1
2: 15
3: 131
4: 881
Right 1054990655 9:71321800-71321822 TCCATGTACATTAATTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054990652 Original CRISPR AAGTATTTGCTGAATGAATA AGG (reversed) Intronic
900008075 1:78770-78792 TAGTATTTGCTTTATGAATCTGG - Intergenic
901442694 1:9288253-9288275 AAATGCTTGCTGAATGAATGAGG + Intergenic
901970953 1:12907702-12907724 AAGTACTTGCTTTATGAATCTGG - Intronic
902014212 1:13294057-13294079 AAGTACTTGCTTTATGAATCTGG + Intergenic
902186980 1:14732921-14732943 AGGTATTTTCTGAATGAACAGGG + Intronic
902287039 1:15413503-15413525 AAGTACCTGCTGAATCAACACGG - Intronic
902605492 1:17566839-17566861 AAAGATTTGCTGAATGAGCAAGG + Intronic
903163448 1:21505251-21505273 AAACATTTGTTGAATGAATAAGG + Intergenic
903533632 1:24051629-24051651 AAGTGTGTGTTGAATGAATGTGG + Intergenic
904907640 1:33909992-33910014 AAGTTCTGGCTGAATGACTATGG - Intronic
905323830 1:37136479-37136501 AAGTATGTGTAGAATGAATGAGG + Intergenic
906151489 1:43590421-43590443 AATTATTTGTTGAATGACTGTGG + Intronic
906265184 1:44423592-44423614 AAATATTTGCTGAATGAAGGAGG + Intronic
906361606 1:45164803-45164825 AAGGATTTGCTTTATGAATCTGG - Intronic
906655541 1:47545737-47545759 GAGTGTTTGTTGAGTGAATAAGG - Intergenic
906757516 1:48332563-48332585 AAGTATTTGCTTTATGAATCTGG - Intronic
906820318 1:48922544-48922566 AAATGTGTGCTGAATAAATAAGG - Intronic
906843323 1:49163198-49163220 AAATATTTGTTGAATGAGTAAGG - Intronic
906997174 1:50808975-50808997 AAGTATTTGCTGTTTGAATCTGG - Intronic
907240129 1:53076717-53076739 ATATATTTGCTGAATGGATGAGG + Intronic
907486676 1:54782727-54782749 ACATATCTGCTGAATGAGTAAGG - Intronic
907490220 1:54804602-54804624 AAATATTTGTTGAATGACAAGGG - Intergenic
907752929 1:57281084-57281106 CAATATTTATTGAATGAATAAGG - Intronic
907788661 1:57639643-57639665 CAGTATTTGTTGAATGAAAGAGG - Intronic
907958937 1:59260314-59260336 AAGTATTTGCCAAATGAATGAGG + Intergenic
908628854 1:66078967-66078989 ATGTATTTCCTGAATAAATAAGG - Intronic
908643619 1:66252611-66252633 TAGTTTCTGCTGAATGCATATGG + Intronic
908921353 1:69197464-69197486 AAGTATTTGCTGATTGAGCCCGG - Intergenic
908935514 1:69371626-69371648 AAGAACTTGCTGTATGAATCTGG + Intergenic
909060968 1:70879123-70879145 AAGTATTTGCTTTATGAATTTGG + Intronic
909093478 1:71256911-71256933 AAATATTTGCTGAACTATTATGG + Intergenic
909406726 1:75298634-75298656 ACCTATTTGATGAAGGAATAAGG + Intronic
909453143 1:75820891-75820913 AAGTACTTGCTTTATGAATCTGG - Intronic
909514217 1:76489314-76489336 AAATATTTGTTGAATAAATGAGG - Intronic
909685138 1:78339437-78339459 CAGTATTTGCTGAAAGTAGAAGG - Intronic
909689127 1:78386749-78386771 AAGTATTTGCTAAATGATGAAGG - Intronic
909803787 1:79848853-79848875 CAGCATTTGCTGAAGGCATATGG + Intergenic
910039523 1:82832702-82832724 ACATATTTGTTGAATGAATGAGG + Intergenic
910586018 1:88880124-88880146 AAATGTTTACTGAATTAATATGG + Intronic
910730469 1:90390406-90390428 AAATGTTTGCTGAAAGAATAGGG - Intergenic
910748291 1:90598346-90598368 AAGTACTTGCTTTATGAATCTGG - Intergenic
911021369 1:93391350-93391372 AAGGACTTGCTGTATGAATCTGG - Intergenic
911252408 1:95592155-95592177 AACTATTTGTTGAATGGAGAGGG - Intergenic
911373851 1:97026227-97026249 AAGAATTTGCTTTATGAATCTGG - Intergenic
911495191 1:98622881-98622903 AAGAACTTGCTGTATGAATCTGG + Intergenic
912470534 1:109903802-109903824 AAATATTTGCTGATTGATTGAGG - Intergenic
912516023 1:110217015-110217037 AAGTGTTTTCTGAATGACTGGGG - Intronic
912579602 1:110708234-110708256 AAATATTTTCTGAATTAATGAGG - Intergenic
912803649 1:112738387-112738409 AAGTGTTTGCTGAAAGCAAAGGG + Intergenic
912884508 1:113455888-113455910 CAGTATTTTCTGATTAAATAAGG + Intronic
913341983 1:117767619-117767641 AAGGATTTGCTTTATGAATCTGG + Intergenic
913501059 1:119473152-119473174 AAGTTTTTGCTGTATGGATATGG - Intergenic
913570379 1:120114041-120114063 ATGTATTAGCTGACTAAATAAGG - Intergenic
914051017 1:144131116-144131138 AATTATTTGCTGAATAAAAAAGG - Intergenic
914128164 1:144834327-144834349 AATTATTTGCTGAATAAAAAAGG + Intergenic
914291183 1:146275018-146275040 ATGTATTAGCTGACTAAATAAGG - Intergenic
914391532 1:147227883-147227905 GACTGTTTGCTGAATGAATATGG - Intronic
914552227 1:148725801-148725823 ATGTATTAGCTGACTAAATAAGG - Intergenic
914725322 1:150322317-150322339 AAATATTTATTGAATGAATTAGG + Intronic
915181312 1:154062994-154063016 AAATATTTGTTGAATGAATGTGG - Intronic
916032395 1:160889238-160889260 AAGTATTAGCTTAACAAATATGG - Intergenic
916312001 1:163407959-163407981 AAGTAGGTGCTCAATGAATGTGG + Intergenic
916367527 1:164048634-164048656 AAGTATTGACAAAATGAATACGG - Intergenic
916784801 1:168078834-168078856 AAGTATTTGTTAAATGAACTGGG + Intergenic
917055339 1:170975803-170975825 AAGAACTTGCTGTATGAATCTGG + Intronic
917064977 1:171082659-171082681 AACTATTGGATGAATGAATAAGG - Intergenic
917266442 1:173225597-173225619 AAGTATTCTCTGAATGAATTAGG + Intergenic
917295435 1:173514310-173514332 AAGAATTTGCTTTATGAATCTGG + Intronic
917316838 1:173734746-173734768 AAATATTTGTTAAATAAATAAGG - Intronic
917697110 1:177536638-177536660 AAGAACTTGCTTTATGAATATGG - Intergenic
917792228 1:178506292-178506314 AAGCCTGTGCTGAATGAACATGG + Intergenic
918039200 1:180901982-180902004 AAATACCTGTTGAATGAATATGG + Intergenic
918416551 1:184314689-184314711 AAATGTTTGCAGAATAAATAAGG - Intergenic
918464456 1:184807241-184807263 TAGTGTTTCCTAAATGAATAAGG - Intronic
918577722 1:186083437-186083459 AAGAGTTTGATGAATGAATTAGG - Intronic
918607328 1:186444046-186444068 GAGTCTTTCCTAAATGAATATGG - Exonic
919249979 1:195042333-195042355 AAGTGTTAGCTGAATAAATAAGG - Intergenic
919586778 1:199448847-199448869 AACTATTTACTGAATCAATATGG + Intergenic
919723537 1:200866313-200866335 AAGTATTTGCAGGAGGAATTTGG - Intergenic
919863595 1:201761093-201761115 AAGATTTTGTTGACTGAATAAGG + Intronic
920012234 1:202877071-202877093 AGGTACTGGCTGAATGAATTTGG + Intergenic
920353704 1:205354742-205354764 GAATATTTACTGAATGAATGAGG + Intronic
920672057 1:208011480-208011502 AAGTATTTGCTAATTTAATAGGG + Intergenic
920991853 1:210947118-210947140 AAATAATTGCTGAATGACTTTGG + Intronic
922405983 1:225314093-225314115 AAGAATTTGCTTTATGAATCTGG + Intronic
922616362 1:226963382-226963404 AAGTATCTGCTGAATGAATGTGG - Intronic
922986731 1:229871775-229871797 AATTGTTGGCTGAATTAATATGG - Intergenic
923373811 1:233339946-233339968 AAGTGTTTGCTGAATGAATGAGG - Intronic
924167626 1:241301547-241301569 AAGTGTTTGCTGAAGGACAATGG + Intronic
924192259 1:241566229-241566251 TAGTATTTGCTGTGTGAAAATGG + Intronic
924331957 1:242948644-242948666 AAGAACTTGCTTTATGAATATGG - Intergenic
1062918251 10:1258636-1258658 AAGGATTTGCTTTATGAATCTGG - Intronic
1063408425 10:5817773-5817795 AAATATTTGACAAATGAATAGGG + Intronic
1063719770 10:8568209-8568231 AAGTATTTGAATAATTAATAAGG + Intergenic
1063855690 10:10250965-10250987 TAATATTTGTGGAATGAATAAGG - Intergenic
1064007305 10:11708947-11708969 AAATATTTGTTGAGTGAATGCGG - Intergenic
1065049905 10:21781081-21781103 AAGTACTTGCTTTATGAATCTGG - Intronic
1065329426 10:24579009-24579031 AAATATTTGTTGGATGAAGAGGG - Intergenic
1065834693 10:29646112-29646134 AAATATTTCTTGAACGAATAAGG + Intronic
1067187642 10:44043981-44044003 AAATAATTGCGGAATGAACAAGG - Intergenic
1067687228 10:48473499-48473521 AAGTGTTTAATGAATGAATGAGG + Intronic
1068109155 10:52658563-52658585 AAGTATTTGTTAGATAAATAAGG + Intergenic
1068223033 10:54067138-54067160 AAGTATTTCCTGGAGGAAAACGG + Intronic
1068260861 10:54579476-54579498 AAGTATTTGTTTTATGAATTGGG - Intronic
1068449531 10:57167569-57167591 AAGAATTTGCTTTATGAATTTGG - Intergenic
1068651836 10:59530685-59530707 AAGAATTTGCTTAATGAATCTGG - Intergenic
1068664572 10:59659486-59659508 AAGAACTTGCTTTATGAATATGG - Intronic
1070672432 10:78387541-78387563 AAATGTTTGCTGAATGAATGTGG + Intergenic
1072250649 10:93579701-93579723 AAATATTTGTTGAATGAATGAGG + Intronic
1072486368 10:95859975-95859997 AAATATTTGTTGAATAAAGATGG + Intronic
1072627462 10:97122293-97122315 AAATGTTTGTTGAATGAATGAGG - Intronic
1072774837 10:98180706-98180728 AAGTACTTGCTTTATGAATCTGG + Intronic
1072936584 10:99719061-99719083 AAATGTTTGTTGACTGAATACGG + Intronic
1073616106 10:104997769-104997791 AAAGATTTGCTGAATGAAAAAGG - Intronic
1073703098 10:105952388-105952410 CAGTATTTACTGACTGAAAAAGG - Intergenic
1074270316 10:111947176-111947198 AAGTAATTGCTTTATGAATCTGG - Intergenic
1074673447 10:115821770-115821792 AAGAATTTGCTTTATGAATCTGG - Intronic
1074720315 10:116258226-116258248 AAATATCTGATGAATGAATTTGG + Intronic
1075135430 10:119781022-119781044 AAGTATTCTATGAATTAATAAGG - Intronic
1075300199 10:121315415-121315437 AAGTGCTTGCTAAATGAATGAGG + Intergenic
1075805124 10:125182608-125182630 AAGGACTTGCTGTATGAATCTGG + Intergenic
1076218098 10:128711727-128711749 GAGTATTTCATGAATGAATGAGG - Intergenic
1077984595 11:7338997-7339019 AAGAATTTGCTTTATGAATCTGG + Intronic
1078417098 11:11174779-11174801 AACTATTTCCTGAAAGAAGAGGG - Intergenic
1078418937 11:11191219-11191241 AAGAATTTGCTTTATGAATCTGG - Intergenic
1078958173 11:16227582-16227604 AAATATTTGTTGAATGAGTTGGG - Intronic
1079271627 11:18992341-18992363 AAGGATTTGCTTTATGAATCTGG + Intergenic
1079287739 11:19154250-19154272 AAGTATTTGTTGAATGAATAGGG + Intronic
1079738880 11:24033366-24033388 AAGAATTTGCTTTATGAATCTGG + Intergenic
1080024877 11:27602571-27602593 AAATATTTGTTGCATGAATAAGG + Intergenic
1080050796 11:27856937-27856959 AAATATTTGTTGAATGAATGAGG + Intergenic
1080379217 11:31750184-31750206 AAGTATTTCCTGGAAGCATATGG + Intronic
1080721056 11:34849084-34849106 AAGGACTTGCTGAATCACTATGG - Intergenic
1080788585 11:35499070-35499092 AAATATCTGTTGAATGAATTCGG + Intronic
1080872220 11:36246433-36246455 AAATATTTACTAAATGAATGAGG - Intergenic
1081041190 11:38216221-38216243 AAGTATTTTCAGAATGAAAATGG + Intergenic
1081043742 11:38245411-38245433 GAGAATTTGGGGAATGAATATGG + Intergenic
1081317490 11:41648708-41648730 AAGAATTTGCTTTATGAATCTGG + Intergenic
1081952434 11:47056007-47056029 AAATATTTGCTGACTGAGTGAGG - Intronic
1082719696 11:56658665-56658687 AAGGACTTGCTTTATGAATATGG + Intergenic
1082992059 11:59215483-59215505 AAGTATGTGCTGCTTGATTAAGG + Intergenic
1083160606 11:60851990-60852012 AAGCATTGGCTAAATGAAGAGGG + Exonic
1083598234 11:63930166-63930188 AAATGTTAGCTGAAGGAATATGG - Intergenic
1084577589 11:69999719-69999741 AAACATTTGCTGAATGAATGAGG + Intergenic
1084983409 11:72845981-72846003 CACTATTTGTTGAATGAATGGGG + Intronic
1085488507 11:76890387-76890409 AAATATTTGTTGAATGAATGAGG + Intronic
1085884671 11:80507589-80507611 AAGAATTTGCTTTATGAATCTGG - Intergenic
1085919381 11:80933778-80933800 AAGTATTTGTTGAAAAAAAAAGG - Intergenic
1086433901 11:86763003-86763025 AAGTATTTCATGAAAGAAGAAGG - Intergenic
1086778121 11:90865659-90865681 AATTATTTGTTAAATGAAAATGG - Intergenic
1086914669 11:92515719-92515741 AAATATTTGTTGAATGAATGAGG + Intronic
1087093209 11:94296837-94296859 AGGTATTTGTTAAATGAACAAGG - Intergenic
1087434550 11:98097509-98097531 AAGAATTTGCTTAATGAGAATGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087583327 11:100087620-100087642 AAGTATTTGCTTTATGAATTTGG - Intronic
1087596377 11:100259282-100259304 AAGGACTTGCTTTATGAATATGG - Intronic
1088470243 11:110182299-110182321 AAATATTTGTTGAATGAATGTGG + Intronic
1088617101 11:111641938-111641960 AAATAGTTGATGTATGAATAAGG + Intronic
1089004505 11:115079682-115079704 ATTTATTTGCTGAATGACTTAGG + Intergenic
1090457190 11:126860431-126860453 AGGAATTTGCTGAATGAAGAAGG + Intronic
1090520807 11:127477020-127477042 AAGTATTTACTCAAGGAATGAGG - Intergenic
1091659555 12:2373237-2373259 GAGCATTTGCTGAATGAATGAGG - Intronic
1091887708 12:4028722-4028744 AAATATTTGCTGAATAAGTGAGG + Intergenic
1092327287 12:7546111-7546133 AAGGACTTGCTGTATGAATCTGG - Intergenic
1092758317 12:11785555-11785577 AAGTATTTGTTGAATCAATTAGG + Intronic
1093177096 12:15924988-15925010 CAGTGTTTGTTGAATGAATAAGG + Intronic
1093264513 12:16986663-16986685 AATTATTTGAAGGATGAATATGG + Intergenic
1093544799 12:20334282-20334304 AAGAACTTGCTGTATGAATCTGG + Intergenic
1094464812 12:30741234-30741256 AAGTACTTGCCTAATGAAAAAGG + Intronic
1095238265 12:39825053-39825075 ATATCTCTGCTGAATGAATACGG + Intronic
1095253535 12:40006107-40006129 AAGTATTAGCTGACTGTATGGGG - Intronic
1095312948 12:40722320-40722342 CAGTTTTTGCTGAAGAAATATGG + Intronic
1095333957 12:41004589-41004611 AAGAATTTGCTTTATGAATCTGG + Intronic
1095645198 12:44536220-44536242 AAGTATTTACTGAGTGAATAAGG - Intronic
1095647065 12:44559665-44559687 AAGGACTTGCTGTATGAATCTGG - Intronic
1095661689 12:44743786-44743808 AAGGATTTGCTTTATGAATCTGG - Intronic
1095680433 12:44968357-44968379 AAGTATTTGTTTATTGACTATGG + Intergenic
1096015830 12:48273750-48273772 AAGAATTTGCTTTATGAATCTGG + Intergenic
1096367803 12:51043396-51043418 AAATATTTATTAAATGAATATGG - Intergenic
1096429156 12:51529104-51529126 AAGTATTTGATACATAAATATGG + Intergenic
1096630958 12:52926440-52926462 AAATGTTTGCGGAATGAATGGGG - Exonic
1096724655 12:53551582-53551604 AAATATCTGCTGAATTAATGAGG + Intronic
1096942089 12:55357715-55357737 AAGAACTTGCTTTATGAATATGG - Intergenic
1097154851 12:57005311-57005333 AAGAATATGCTCAATGAATTAGG - Intronic
1097448947 12:59712591-59712613 CAGTAGTTTCTGAATGAAAACGG - Intronic
1097512623 12:60562984-60563006 AAGAACTTGCTTTATGAATATGG + Intergenic
1097917544 12:65036640-65036662 AAGTACTTGCTTTATGAATCTGG + Intergenic
1097952216 12:65444229-65444251 AAGTAGGTGCTCAATCAATATGG - Intronic
1098045271 12:66393858-66393880 AAGTGTTTGCTGAATGAAATTGG + Intronic
1098098715 12:66989329-66989351 AAGTTTTTACTGAATGAATGTGG + Intergenic
1098961463 12:76743975-76743997 AAGCATTTGCTTATGGAATAGGG + Intergenic
1099134750 12:78882158-78882180 AAACGTTTGCTGAATGAATGGGG + Intronic
1099260187 12:80370002-80370024 AAATATTTCTTGAAAGAATAGGG + Intronic
1099463759 12:82956877-82956899 AAGTACTTGTTTCATGAATATGG - Intronic
1099593723 12:84629436-84629458 AAGAATTTGCTGATTGACCAGGG + Intergenic
1099754854 12:86832422-86832444 AATATTTTGCTGAATGAGTATGG - Intronic
1100025187 12:90119621-90119643 TAATATTTGCTTTATGAATATGG + Intergenic
1100149512 12:91719194-91719216 AAATATTTGTTAAATAAATATGG + Intergenic
1100603973 12:96135817-96135839 ATGTATTGAATGAATGAATAGGG - Intergenic
1100760885 12:97805412-97805434 AATTATTTTCTGAATGTAGAAGG - Intergenic
1100808519 12:98313236-98313258 AAGGACTTGCTTTATGAATATGG - Intergenic
1100874344 12:98946405-98946427 AATTATTTGTTGAATGAATGAGG - Intronic
1100888056 12:99094283-99094305 AAGTATTTACTGTATTAGTAGGG + Intronic
1100889189 12:99104994-99105016 AAATATTTGTTAAATGAACATGG + Intronic
1100945271 12:99776427-99776449 ACCTATTAGCTGAATGAACATGG - Intronic
1100977714 12:100139703-100139725 AACTATTTGTTGCATGAATGTGG - Intronic
1101143680 12:101821300-101821322 AAGTAGTCACTGAATGAATGAGG + Intronic
1101161730 12:101984372-101984394 AAATATTTTTTGAATGAATGAGG - Intronic
1101686048 12:107022518-107022540 AAATATTTTCTGTATGAAAATGG + Intronic
1102362182 12:112297515-112297537 CAGTATTTGCTGACTAGATATGG + Intronic
1104010421 12:124926259-124926281 AAATATTTGTAAAATGAATATGG + Intergenic
1104164226 12:126211321-126211343 AATTATGTGCTGAATGAAGGGGG + Intergenic
1104527842 12:129540783-129540805 AAGTATTTGTTGAATGAGGCTGG - Intronic
1105301599 13:19140507-19140529 CAGCATTTGCTGACTAAATATGG - Intergenic
1105491461 13:20892502-20892524 TAATATTTGTTGAATGAAAAAGG - Intronic
1105734324 13:23252281-23252303 AAATATTTGTTGAATGACTATGG + Intronic
1106445532 13:29827338-29827360 AAGGATTTGCTTTATGAATCTGG + Intronic
1106465618 13:30011909-30011931 GTCTATTTGCAGAATGAATAAGG + Intergenic
1106544960 13:30722528-30722550 AAGTATTTGTTGAATGAGTGAGG + Intronic
1106831602 13:33589954-33589976 AAGAATTTGCTTTATGAATCTGG + Intergenic
1106838063 13:33657325-33657347 AAGTATTTTTTGAATGAATCAGG - Intergenic
1107187615 13:37543060-37543082 AAGAATTTGCTTTATGAATCTGG + Intergenic
1107378807 13:39833547-39833569 AAATGTTTGTTGGATGAATAAGG - Intergenic
1107439813 13:40415724-40415746 AAGGACTTGCTTTATGAATATGG - Intergenic
1107580122 13:41774490-41774512 AAGTATTTGTTGAATGTCTACGG + Intronic
1107884660 13:44865455-44865477 ACCTATTTGCTGAATGAATTAGG + Intergenic
1108247073 13:48528064-48528086 TAATATTTGTTGAATGAATTAGG - Intronic
1108479941 13:50858403-50858425 AAGGACTTGCTGTATGAATCTGG - Intergenic
1108850067 13:54717704-54717726 AAGTACTTGCTTTATGAATCTGG + Intergenic
1109095170 13:58105222-58105244 AAGTACTTGTTTTATGAATACGG + Intergenic
1109905437 13:68833382-68833404 AAGTATTTGCACTATGAAAATGG - Intergenic
1110105752 13:71674077-71674099 AAATATTTGTTCAATGAATATGG - Intronic
1110178660 13:72588888-72588910 AAATATTTGTTGAATGATTTGGG - Intergenic
1110961524 13:81632141-81632163 AAGAATTTGCTTTATGAATCGGG - Intergenic
1111114439 13:83756865-83756887 AAGAATTTGCTTTATGAATCTGG - Intergenic
1111235064 13:85399165-85399187 AAGAATTTGCTTTATGAATCTGG + Intergenic
1111358519 13:87143038-87143060 TGGTATTTGCAGAAAGAATAGGG - Intergenic
1111680556 13:91436842-91436864 AAGTACTTGCTGTATGAATCTGG + Intronic
1111956317 13:94762502-94762524 AAGTGTTTGTTGGATGAATAGGG + Intergenic
1112076392 13:95917873-95917895 AAGAATTTGCTTTATGAATCTGG - Intronic
1112102460 13:96204339-96204361 AAGAATTTGCTTTATGAATCTGG - Intronic
1112425299 13:99292820-99292842 AAGTATTTTCTCCATGAATCGGG - Intronic
1112712515 13:102146472-102146494 AAGTATTGGTTGAACGAATTAGG - Intronic
1114359557 14:21956653-21956675 AAGAATTTGCTTTATGAATCTGG + Intergenic
1114662217 14:24354267-24354289 AAATATTTGCTGAATGAGGGAGG - Intergenic
1114730539 14:24988264-24988286 AAATGTTTGTTGAATGAAGAAGG - Intronic
1115689928 14:35832082-35832104 AATTAGTTGCTCAATGAACAAGG - Intronic
1115926896 14:38446282-38446304 AAGAATTTGCTTTATGAATCTGG + Intergenic
1116094860 14:40354143-40354165 AAGTATTTGGTCTAAGAATAAGG + Intergenic
1116165335 14:41328018-41328040 AAGGATTTGCTTTATGAATCTGG + Intergenic
1116166388 14:41339085-41339107 AAGTACTTGCTTTATGAATTTGG - Intergenic
1116295586 14:43102902-43102924 TAGTATTTGCTTTATGAATCTGG - Intergenic
1116591610 14:46783012-46783034 AAGAATTTGTTTAATGAATCTGG - Intergenic
1116727012 14:48573886-48573908 AAGTACTTGCTTTATGAATCTGG + Intergenic
1116766745 14:49081584-49081606 AAGTACTTGCTTTATGAATCTGG + Intergenic
1117081905 14:52160277-52160299 AAGGACTTGCTTTATGAATATGG - Intergenic
1118285064 14:64464005-64464027 ACGTGTTTGCTGAGTGAACAAGG + Intronic
1118692243 14:68351408-68351430 AATTATTTGATGAATGTTTATGG + Intronic
1119275185 14:73349019-73349041 AAATAACTGCAGAATGAATATGG - Intronic
1119404043 14:74385181-74385203 AAGGACTTGCTTTATGAATATGG + Intergenic
1119656898 14:76423702-76423724 AAATATTTGTTGAATGAGTAAGG - Intronic
1120137519 14:80887114-80887136 AAGTACTTGCTTTATGAATCTGG - Intronic
1120216702 14:81688224-81688246 GGGTATTTGCTTAATAAATAGGG - Intergenic
1120404841 14:84081936-84081958 AAGTATTTGTTGAAGGAATAAGG - Intergenic
1120577494 14:86201308-86201330 AAGGATTTGCTTTATGAATCTGG + Intergenic
1120667580 14:87324915-87324937 AAGTATTAGTTGACTGAATTTGG - Intergenic
1121521107 14:94586825-94586847 CAGCGTTTGCTGAATGAACAGGG + Intronic
1121574626 14:94973705-94973727 AAGTATTTTTTTAATGAATCAGG + Intergenic
1121807068 14:96837149-96837171 AAATATCTGTTTAATGAATATGG + Intronic
1121920409 14:97875624-97875646 CTGCATTTGCAGAATGAATAGGG - Intergenic
1122663209 14:103311586-103311608 TAGTATTTGCTGAATGAAACTGG - Intergenic
1123576371 15:21674145-21674167 AAGGACTTGCTTTATGAATATGG + Intergenic
1123612995 15:22116613-22116635 AAGGACTTGCTTTATGAATATGG + Intergenic
1124162527 15:27285980-27286002 AAATATTTGATGAATTAATTAGG + Intronic
1124269398 15:28266939-28266961 ATGTATTTGTTAAATGAATGTGG + Intronic
1124854049 15:33369757-33369779 AAATATTTTCTGAGTGAATGAGG + Intronic
1124903305 15:33844727-33844749 CATTACTTGCTGAATGAATGAGG - Intronic
1125211983 15:37227364-37227386 AAATATTTGTTGCATGAATAGGG + Intergenic
1125439660 15:39688501-39688523 AGGTTTCTGCTGAATGCATATGG + Intronic
1125803019 15:42467418-42467440 AAATATTTGGTGAATGAATGAGG - Intronic
1126023716 15:44426676-44426698 AAATATTTCTTGATTGAATAAGG + Intergenic
1126074273 15:44894180-44894202 AAGGATTTGCTTTATGAATCTGG + Intergenic
1126387183 15:48106313-48106335 AAATATTTACTGAATGAACAAGG - Intergenic
1126551736 15:49938594-49938616 AAGTACTTGTTTTATGAATATGG - Intronic
1127121473 15:55775764-55775786 AAATATTTGTTGACTGCATAAGG + Intergenic
1127296593 15:57614219-57614241 AAATACTTGCTGAATGAATAGGG - Intronic
1127414079 15:58739878-58739900 CAATATCTGCTGAATGAAAACGG + Intronic
1128425352 15:67537275-67537297 TAATATTTGCTGACTGAACAGGG - Intergenic
1128572460 15:68744465-68744487 AAGTATTTTATGAATTAAAAAGG + Intergenic
1128607027 15:69044233-69044255 AAATATTTGCTAAATGAACAAGG - Intronic
1128614370 15:69097837-69097859 AAATATTTGCTGAATGAATGAGG + Intergenic
1130138497 15:81202126-81202148 AAATATTTGTTGAATGACTAAGG - Intronic
1130151308 15:81313677-81313699 AAGCATTTGCTGAGTGAATCGGG - Intronic
1130424248 15:83779100-83779122 AAGAATTTGCTTTATGAATTTGG - Intronic
1130566353 15:84999452-84999474 AAAGGTTTGCTGAATGAATGAGG - Intronic
1131256598 15:90866823-90866845 ATTTCTTTGCTGAATAAATAAGG - Intergenic
1131569284 15:93517473-93517495 AAATATTTGTTAAATGAAAAGGG + Intergenic
1131780829 15:95856982-95857004 AAGTATGTGCTGGAAGAATGGGG - Intergenic
1131967038 15:97855192-97855214 AGGTATTTGCTGAAGGCAAAAGG + Intergenic
1132139502 15:99380192-99380214 AAGTACTTGCTTTATGAATCTGG + Intronic
1132175198 15:99708616-99708638 AAATATTTGCTGAATAGATGTGG - Intronic
1132445481 15:101913340-101913362 TAGTATTTGCTTTATGAATCTGG + Intergenic
1202985239 15_KI270727v1_random:408390-408412 AAGGACTTGCTTTATGAATATGG + Intergenic
1134162522 16:11903049-11903071 CAGTAACTGCTAAATGAATACGG - Intronic
1135078172 16:19411790-19411812 AAATACTTGTTGAATGAATAAGG + Intronic
1135903214 16:26486154-26486176 AAATATTTGATGAATATATAAGG + Intergenic
1136994793 16:35182149-35182171 AGGTCTTTGTGGAATGAATATGG - Intergenic
1137025624 16:35471022-35471044 AAGAATTTGCTTTATGAATCTGG - Intergenic
1137318186 16:47349546-47349568 AAGGACTTGCTGTATGAATCTGG - Intronic
1137385174 16:48035210-48035232 ATGTATTTGTTGAGTAAATAGGG - Intergenic
1137812517 16:51365977-51365999 AAATATTTACTGGATGAATAGGG + Intergenic
1138145694 16:54609038-54609060 AAGTCTTAGCTGATGGAATAAGG + Intergenic
1138161103 16:54755575-54755597 AAGTATTTCCTAGATGAATCTGG + Intergenic
1138934796 16:61706028-61706050 ATGTATTGAATGAATGAATAAGG + Intronic
1138980771 16:62265389-62265411 AAGAATTTGATAAATGAATCTGG - Intergenic
1140066480 16:71615685-71615707 CAGGATTTGCTGAATAGATATGG - Intergenic
1140590465 16:76345815-76345837 AAGTAAATGCTGTATGAAAAGGG + Intronic
1140714173 16:77706946-77706968 TATTACTTGTTGAATGAATATGG + Intergenic
1141039706 16:80662509-80662531 AAGTATGTACTGAATGAACATGG - Intronic
1141237301 16:82230322-82230344 AAGTATTTGCTGAACGGGAAAGG - Intergenic
1141336098 16:83156775-83156797 ACATCTGTGCTGAATGAATACGG - Intronic
1141499689 16:84435463-84435485 AAATATTTGCTGCATGAAGAAGG - Intronic
1142648735 17:1332060-1332082 AAGTTTTTACTAAATGAATATGG - Intergenic
1142679517 17:1538271-1538293 AAGTATTTGCTCAGGGAATGAGG - Intronic
1143055841 17:4161181-4161203 AGTTATTTGCTGAATGACTAAGG - Intronic
1143271743 17:5680893-5680915 AATTATTTGGTGAATGCAAAAGG + Intergenic
1144743618 17:17598370-17598392 GAATATTTGCTGAATGAAGGAGG + Intergenic
1145294850 17:21580484-21580506 AATTATGTGCTGAATAAAAAAGG - Intergenic
1145353502 17:22112753-22112775 AAGTATGTGTTTTATGAATATGG + Intergenic
1145368984 17:22292692-22292714 AAATATGTGCTGAATAAAAAAGG + Intergenic
1146325933 17:31885836-31885858 AAGTATTTTCTGAAAGAAACAGG + Intronic
1146561720 17:33875692-33875714 AAGAAGATGCTTAATGAATATGG + Intronic
1146606914 17:34268416-34268438 AAGGATTTTCTGAAGGAAAAAGG + Intergenic
1146766436 17:35526194-35526216 AAGAATTTGCTTTATGAATCTGG - Intronic
1148498439 17:48069885-48069907 AAGTATTTACTAAATTAACATGG + Intergenic
1148865327 17:50625362-50625384 GACTATTTGCAGAATGAATAAGG - Intronic
1148888033 17:50787538-50787560 AAATGTTTGCTGAATGAAAATGG - Intergenic
1149004824 17:51794648-51794670 AAATATTTGTTGAAAGAATAAGG - Intronic
1149609173 17:57947189-57947211 AAATACTTTCTTAATGAATAGGG + Intronic
1150055001 17:62006537-62006559 AAGTATTTATTGAATGAGCAAGG + Intronic
1150745131 17:67810617-67810639 AAATATTTGTTGAGTGAGTAAGG + Intergenic
1151817088 17:76476734-76476756 AAACACTTGCTGAATGAGTAAGG + Intronic
1153323905 18:3798713-3798735 AAGTATATGCTTACTGTATAGGG + Intronic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1154023005 18:10681958-10681980 AAATACTTGATGTATGAATAAGG - Intronic
1155178960 18:23326538-23326560 AAGGACTTGCTTTATGAATATGG - Intronic
1155285563 18:24285253-24285275 AAATATTTATTAAATGAATAAGG + Intronic
1156234507 18:35188823-35188845 AAGTACTTGCCGAATGAAACTGG + Intergenic
1156322129 18:36036671-36036693 AATTATTTGCTGTATGTATAGGG - Intronic
1156389194 18:36634829-36634851 AGGTAATTGTTAAATGAATATGG + Intronic
1156770451 18:40714993-40715015 AAGTTTTTGATGAATTTATATGG - Intergenic
1156953091 18:42928933-42928955 AAATATTTGATGAATGAGTTAGG - Intronic
1157097303 18:44697542-44697564 AAGGTTTTTCTGAATGAAAATGG - Intronic
1157178603 18:45475512-45475534 AAGAACTTGCTTTATGAATATGG + Intronic
1157836800 18:50911351-50911373 AAATATTTGGTGAATAAATGAGG - Intronic
1157882917 18:51338981-51339003 AAATAGTGGCTGAATGAATTTGG + Intergenic
1158485222 18:57860191-57860213 AAATATTTGATGCATGAAAATGG - Intergenic
1159173710 18:64807031-64807053 ACATATTTGCTGAATAATTAAGG + Intergenic
1159575858 18:70176381-70176403 AATTATTCACTGAATGAACAAGG + Intronic
1159634938 18:70793787-70793809 AAGTATATGCTGTAAGAATTTGG - Intergenic
1159640024 18:70852936-70852958 AAGTATTTGCTGAATGCAAAAGG - Intergenic
1159858732 18:73620142-73620164 AAGTATATTCTGGATGAAAAGGG - Intergenic
1159907179 18:74104920-74104942 AATCAATGGCTGAATGAATAAGG + Intronic
1160639829 19:120367-120389 TAGTATTTGCTTTATGAATCTGG - Intergenic
1161495435 19:4583691-4583713 AAATGTTTGCTGAATGACTAGGG - Intergenic
1161507128 19:4650074-4650096 AAACATCTGCTGAATGAAGAGGG - Intronic
1162125218 19:8495973-8495995 AAGTTTGTGCTGGGTGAATAGGG - Intronic
1162162405 19:8728316-8728338 AAGTATTGCCTGAGTGAATGAGG - Intergenic
1162466083 19:10841630-10841652 AAATATTTGGTGAATAATTAGGG - Intronic
1163070132 19:14832993-14833015 TATTATTTGCTGAATGAATCAGG + Intronic
1164132919 19:22382326-22382348 AAGGACTTGCTTTATGAATATGG + Intergenic
1164165899 19:22674405-22674427 AAGGACTTGCTTTATGAATATGG - Intergenic
1164265830 19:23615883-23615905 AAGGACTTGCTTTATGAATATGG - Intronic
1164497546 19:28781452-28781474 CAGTATTTGTTTTATGAATATGG + Intergenic
1165360948 19:35336627-35336649 ACGTATTTATTGAATGAATGAGG - Intronic
1165366297 19:35368327-35368349 AACTATTTCCTGAATGACTTTGG + Intergenic
1165829863 19:38725080-38725102 AAGCATTTGTTGAAGTAATAAGG - Intronic
1166372817 19:42311717-42311739 AGGGATTTGCTGAGTGAAAATGG - Intergenic
1167376264 19:49114084-49114106 AAGAGTTTGTTGAATGAATGTGG + Intergenic
1168569715 19:57456128-57456150 AAATATTTGCTGAATGACACTGG - Exonic
1202690425 1_KI270712v1_random:83754-83776 AATTATTTGCTGAATAAAAAAGG - Intergenic
925375952 2:3386024-3386046 AATTATTGGATGAATGTATAAGG + Intronic
926366359 2:12137111-12137133 AAGGATTTGCTTTATGAATCTGG + Intergenic
926464673 2:13172973-13172995 AAGTATTGGCTGAAGAAATTTGG + Intergenic
926925836 2:17986778-17986800 AAGGACTTGCTTTATGAATATGG + Intronic
926987096 2:18636932-18636954 AAGAATTTGCTTCATGAATCTGG + Intergenic
927335633 2:21920560-21920582 AAATATTTGCTGAATCAAATTGG + Intergenic
927447222 2:23174005-23174027 AAGGATTTGCTTTATGAATCTGG - Intergenic
927717729 2:25363411-25363433 AAATTTTTGCTAAGTGAATAAGG + Intergenic
928036083 2:27824748-27824770 AAGTATTTGCCTCATGAAAATGG - Intronic
928400997 2:30978722-30978744 CAGTATCAGCTGAGTGAATAGGG - Intronic
928669487 2:33586103-33586125 AACTATCTGCTGAATGACCAAGG + Intronic
928869568 2:35960957-35960979 AAATGTTTGCTGAATGGATGTGG + Intergenic
929308658 2:40396622-40396644 AAATATTTAATGAATTAATAAGG - Intronic
929883476 2:45857874-45857896 AAATATTTGTTAAATGATTAAGG + Intronic
930092050 2:47538089-47538111 AAATGTTTGTTGAATGAATGTGG - Intronic
930229675 2:48830293-48830315 AAGTATTTGCTTTATGACTCTGG - Intergenic
930272574 2:49274087-49274109 GAATATTTGCTGACTGCATAAGG - Intergenic
930603666 2:53470270-53470292 AATTCTTTGGTGAATGAATGAGG - Intergenic
930805041 2:55482283-55482305 AATTATTTCCTGGATGAATTTGG + Intergenic
931693373 2:64854037-64854059 AAGTGATTGCTTAATGAGTATGG + Intergenic
931998629 2:67863284-67863306 AACTATCTGAAGAATGAATAAGG - Intergenic
932205047 2:69872916-69872938 AAATGTTTGCTGAAGGAACATGG - Intronic
933166387 2:79081399-79081421 AAGAACTTGCTCAATGAATCTGG + Intergenic
933438135 2:82275308-82275330 AAGAATTTGCTTTATGAATCTGG + Intergenic
933450819 2:82448284-82448306 AAATAGTTCCTGAAGGAATAAGG + Intergenic
933482814 2:82878167-82878189 AAGAATTTGCTTTATGAATCTGG - Intergenic
933554969 2:83820932-83820954 AAGAATTTGCTTTATGAATATGG + Intergenic
933607504 2:84399062-84399084 AAGAATTTGCTTTATGAATCTGG - Intergenic
933873514 2:86594509-86594531 AAGCATCTACTGAATGAATGAGG - Intronic
933880666 2:86666185-86666207 AAGGATTTGCTTTATGAATCTGG - Intronic
934462591 2:94227566-94227588 AATTATTTGCTGAATAAAAAAGG + Intergenic
934549242 2:95244528-95244550 AAGAACTTGCTTTATGAATATGG - Intronic
934592971 2:95574530-95574552 AAGTAACTACTGAATGACTATGG - Intergenic
934629014 2:95894943-95894965 AATTATTTTCCGAATGAAGACGG - Intronic
934629428 2:95900559-95900581 AATTATTTTCCGAATGAAGACGG - Intronic
934629843 2:95906175-95906197 AATTATTTTCCGAATGAAGACGG - Intronic
934630520 2:95915524-95915546 AATTATTTTCCGAATGAAGATGG - Intronic
934803671 2:97195351-97195373 AATTATTTTCTGAATGAAGACGG + Intronic
934804087 2:97200959-97200981 AATTATTTTCTGAATGAAGACGG + Intronic
934832960 2:97550833-97550855 AATTATTTTCTGAATGAAGACGG - Intronic
935013750 2:99159686-99159708 AAATACTTGTTGAATGAATATGG + Intronic
935170278 2:100605981-100606003 AATTGTTTGCTGAATTAATGAGG - Intergenic
935316385 2:101838861-101838883 AAATTTTTGTTGAATGAATGAGG - Intronic
935680216 2:105629365-105629387 AAATATTGGTTGAATGAATCAGG - Intergenic
936171838 2:110183642-110183664 AAGAACTTGCTGTATGAATCTGG - Intronic
936237790 2:110759331-110759353 AAGAATTTGCTTTATGAATCTGG + Intronic
937040622 2:118817863-118817885 AAGTAGTTCCAGAATGAAAACGG + Intergenic
937082060 2:119147250-119147272 AATTGTTTGGAGAATGAATATGG + Intergenic
937784939 2:125885785-125885807 AAGTACTTGCTGAAGGCAAAGGG - Intergenic
938837648 2:135123178-135123200 AAGTTTTAGCTGAATTAAAAAGG - Intronic
939480246 2:142739332-142739354 AAGTATCTGCTGGATTAAAAAGG + Intergenic
939511035 2:143104960-143104982 AAGTAGTTGCTGAATGAATTAGG + Intronic
939594468 2:144106592-144106614 AAGGATTTGCTTTATGAATCTGG - Intronic
939656786 2:144836114-144836136 AAGTATTTTGTGAATGCAAAGGG + Intergenic
939738337 2:145877453-145877475 AAGGCTTTGCGGAATGAAAAAGG + Intergenic
940406380 2:153307197-153307219 AAGTATTTGCATTATGAAAATGG + Intergenic
940542703 2:155042791-155042813 AGGTTTTTCCTGAATGACTAAGG + Intergenic
940624231 2:156151937-156151959 AAATATTTGTTGAATGAATGAGG - Intergenic
940627085 2:156188470-156188492 AAATATTTGCTGAATGAGCCAGG + Intergenic
940720521 2:157277475-157277497 AAGGATTTGCTTTATGAATCTGG + Intronic
941185857 2:162320508-162320530 AAGGGGTTGCTGACTGAATATGG + Intronic
941415572 2:165216778-165216800 AAGTATTTACTGAAAGCTTAGGG + Intergenic
941439728 2:165519637-165519659 AAATATTTGTTGAATGATTATGG - Intronic
941633161 2:167906370-167906392 TAGTACTTGCTTAATAAATAGGG + Intergenic
941888117 2:170550578-170550600 AAATGTTTGTTGAATGAATGAGG - Intronic
942333682 2:174856812-174856834 AAGTATGTGCTGAAAGATTTGGG + Intronic
942407467 2:175670799-175670821 AAGAATTTGCTTTATGAATGTGG - Intergenic
942744339 2:179214477-179214499 AAGGATTTGCTTTATGAATCTGG - Intronic
942806280 2:179934792-179934814 AAACATTTGATGAATGAATGGGG - Intergenic
942916023 2:181308052-181308074 AAATATTTGCTGAAGAAATCTGG + Intergenic
943399946 2:187395578-187395600 AAGTAGATGCTCAATAAATAGGG - Intronic
943837077 2:192526962-192526984 AAGAATTTGCTTGATGAATATGG - Intergenic
944691040 2:202158752-202158774 TGGTAATTGATGAATGAATAAGG + Intronic
944699341 2:202232326-202232348 AAACATTTGTTGAATGAATCTGG + Intronic
945201844 2:207289703-207289725 GAGTATTTGATGAATGATGAGGG - Intergenic
945572429 2:211485629-211485651 AAGAATTTGCTGTTTGAATTAGG - Intronic
945927667 2:215821819-215821841 AAGAACTTGCTTAATGAATCTGG - Intergenic
946040581 2:216780099-216780121 AAGTACCAGCTGACTGAATATGG + Intergenic
946139544 2:217677790-217677812 AAGTACTTGCTTTATGAATCTGG + Intronic
946528608 2:220547242-220547264 AAGTGTTTACTGAATTCATATGG - Intergenic
946789975 2:223291272-223291294 AAGAATTTGCTTTATGAATCTGG + Intergenic
946947089 2:224832289-224832311 CAGAATTTGTTGAATGAAAAAGG - Intronic
947205225 2:227654812-227654834 AAGTGTTTGCTAAATAAATGAGG + Intergenic
948026098 2:234777952-234777974 AAGTACTTGCTTTATGAATCTGG - Intergenic
948115108 2:235489484-235489506 AAAGATTTGCTGAATTAAAATGG - Intergenic
1168889362 20:1284341-1284363 AAATCTTTGCTGAATGAATAAGG - Intronic
1169645980 20:7810508-7810530 AAGAATTTGCTTTATGAATCTGG + Intergenic
1169732377 20:8800266-8800288 GTGAATTTGCTGCATGAATATGG - Intronic
1170011179 20:11725782-11725804 AAATATTTGCTTAATTAACATGG + Intergenic
1170815832 20:19713533-19713555 ACGTAACTGATGAATGAATAAGG - Intronic
1171005283 20:21458866-21458888 AAGCATTTGCTGCAGGAAAACGG + Intergenic
1171153918 20:22853878-22853900 AAGGATTTGCTTTATGAATCTGG - Intergenic
1171222076 20:23407608-23407630 AAATATTTCCTGAATAAGTACGG - Intronic
1171312686 20:24157961-24157983 AAGTATTTGTTTTATGAATCTGG + Intergenic
1171443296 20:25184484-25184506 AAGGACTTGCTGTATGAATCTGG + Intergenic
1171563758 20:26156954-26156976 AAGTATGTGTTTTATGAATATGG + Intergenic
1172277652 20:33688689-33688711 AAGTGTTTGTTGAATGACTTGGG - Intergenic
1172441462 20:34969294-34969316 AAGTGTTTGCTAAATGAATAAGG - Intergenic
1172955849 20:38758220-38758242 GAGTATCTGCTGAAAGAATGGGG - Intronic
1173091090 20:39972792-39972814 AAGAATTTGCTTTATGAATCTGG + Intergenic
1173259001 20:41416484-41416506 AAGTATTTACTGAGTGGATAGGG - Intronic
1173534640 20:43800196-43800218 GAGTGTTTGCTGAATGAGAATGG - Intergenic
1174310110 20:49646226-49646248 AAATATTTTCTGAATAAATTTGG + Intronic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1174574629 20:51527609-51527631 ATGTGTTGGCTGAATGAATGAGG + Intronic
1174989660 20:55496130-55496152 AAGTACTTGCTTTATGAATCTGG + Intergenic
1174992743 20:55530159-55530181 AAGTTTTTGTTGAATTAATGCGG - Intergenic
1175012283 20:55750704-55750726 AAATGTTTGTTGAATGAATGAGG - Intergenic
1175623870 20:60474329-60474351 AAGAATTTGATGAAGAAATAAGG - Intergenic
1176976802 21:15330334-15330356 AAATGTGTGCTGAATGTATAAGG - Intergenic
1178795868 21:35743735-35743757 AAATATTTGTCGAATGAATAAGG - Intronic
1178965366 21:37111535-37111557 AAGGACTTGCTGTATGAATCTGG - Intronic
1179279439 21:39921876-39921898 AAGTATCTGCTGATGGACTATGG + Intronic
1182009590 22:26989463-26989485 AATTATCTGTTGAATGAATGAGG + Intergenic
1182063980 22:27417393-27417415 AGGTATTTGCTGAAGGAAGGAGG + Intergenic
1182563374 22:31179524-31179546 AAATATTTGCTGAGTGAGGATGG - Intronic
1182790042 22:32943934-32943956 AAGGACTTGCTGTATGAATCTGG - Intronic
1182805390 22:33065629-33065651 ACATTATTGCTGAATGAATAAGG + Intergenic
1183339345 22:37270998-37271020 AAATATATGTTGAATGAATAAGG + Intergenic
1183480956 22:38065295-38065317 TAGTATTTATTGAATGAATGAGG - Intronic
1183570422 22:38649133-38649155 AAGTATTTGTGGAAAGAATGGGG - Intronic
1183797458 22:40131545-40131567 AAATATGTGCTGAATTAATCAGG - Intronic
949095037 3:75753-75775 AAGTATGTGCTGTATAATTATGG - Intergenic
949191005 3:1248926-1248948 AAGCATTAGTTGAATGATTAAGG - Intronic
949500329 3:4673912-4673934 AAATATTTGCAGAATGAAAGAGG - Intronic
949684405 3:6551856-6551878 AAGTATTAGTTGAATGGATTAGG + Intergenic
949687191 3:6589248-6589270 AAGGATTTGCTTTATGAATTTGG - Intergenic
949779122 3:7665940-7665962 AAATAATTTTTGAATGAATAAGG - Intronic
949978033 3:9478388-9478410 AAATAGTTGCTGAATGAATGAGG - Intronic
950016590 3:9758937-9758959 AAGTATTTGCTGCATAGAAAGGG - Intronic
950455650 3:13091383-13091405 AAATATTTGCCGAATGAATGAGG + Intergenic
950566051 3:13770351-13770373 AAGTATTTATTGGATGAATGAGG + Intergenic
950613832 3:14143252-14143274 AAGTATTTGGTAGCTGAATAAGG + Exonic
950625965 3:14247033-14247055 ATATGTTTGCTGAATGAATGAGG - Intergenic
950929865 3:16778012-16778034 AAGGACTTGCTTAATGAATCTGG - Intergenic
951073060 3:18354846-18354868 AAATATTTGTTGAATGAGTCGGG - Intronic
951296991 3:20949730-20949752 AAGAATTTGCTTTATGAATCTGG + Intergenic
951747571 3:25996772-25996794 AAGGATTTGCTTTATGAATCTGG + Intergenic
951849626 3:27124691-27124713 AAGAATTAGCTGAAGGAAAACGG + Intronic
951870220 3:27353706-27353728 AAATATTTGTTGAATGAAAGAGG - Intronic
952101830 3:30022720-30022742 AAGAATTTGCCAGATGAATAAGG + Intergenic
952118534 3:30214035-30214057 AAGGACTTGCTTTATGAATACGG + Intergenic
952144048 3:30512329-30512351 AATTATATGCTGGGTGAATATGG + Intergenic
952506269 3:34009206-34009228 AAATGTCTGATGAATGAATAAGG - Intergenic
952560753 3:34590709-34590731 AAGAACTTGCTTTATGAATATGG + Intergenic
952575148 3:34765555-34765577 AAGGACTTGCTTAATGAATCTGG - Intergenic
952939955 3:38435431-38435453 TAATATTTGCTTTATGAATATGG - Intergenic
953242225 3:41159803-41159825 AAATATTTCCTGAATGGATAAGG + Intergenic
953516186 3:43594097-43594119 AAGGATTTGCTTTATGAATCTGG - Intronic
954742636 3:52766507-52766529 AGGTATTTGCTTGTTGAATAAGG - Intronic
954937969 3:54344370-54344392 AAATATTTGGTGATTGAATGAGG + Intronic
955074873 3:55604100-55604122 AAGGATTTGTTGAATCATTAAGG - Intronic
955145410 3:56313421-56313443 AAATATTTGCTGAATGAAAATGG - Intronic
955684192 3:61533622-61533644 AAATATTTACTGTAAGAATATGG - Intergenic
955795303 3:62630174-62630196 AAGCATGTATTGAATGAATAAGG + Intronic
955929718 3:64044607-64044629 AAATATGTGTTGAATGAATTAGG - Intergenic
956536568 3:70283332-70283354 CAATAGTGGCTGAATGAATAGGG + Intergenic
956579531 3:70795063-70795085 AAGGACTTGCTTTATGAATATGG + Intergenic
956611798 3:71131301-71131323 CAGTATTTGCTGAATTACTCCGG - Intronic
956935662 3:74098446-74098468 AAATATTTGCTGACTAAATGAGG - Intergenic
957117720 3:76047925-76047947 AATTATATTCTTAATGAATATGG + Intronic
957320528 3:78624607-78624629 AAGTATTTGATGAATGGAATCGG - Intronic
957430666 3:80101598-80101620 TAATATTTGCTAAATCAATAAGG - Intergenic
957446029 3:80313960-80313982 AAGAACTTGCTTTATGAATATGG - Intergenic
957650108 3:82990154-82990176 AAGTATTCATTGAATGAATTTGG + Intergenic
957860655 3:85944258-85944280 AAGGATTTGCTTTATGAATCTGG - Intronic
958024824 3:88038507-88038529 AAGTTTTTGCTGAAGGCAAAGGG - Intergenic
958174609 3:89980603-89980625 AAGTATTTGCTCAAAAATTAAGG - Intergenic
958584240 3:96065906-96065928 AAGTACTTCCTAAATCAATATGG - Intergenic
958615720 3:96491535-96491557 AAGAATTTGTTTTATGAATATGG + Intergenic
958624288 3:96604994-96605016 AAGGATTTGCTTTATGAATCTGG + Intergenic
958993425 3:100873851-100873873 TAGTATTTGTTGAATGACTGTGG + Intronic
959218311 3:103481811-103481833 AAGAATTTGCTTTATGAATCTGG + Intergenic
959397545 3:105859800-105859822 AATTATTTGCTGCATTAAAATGG - Intronic
959623099 3:108420475-108420497 AAGTCTTTCCAGAATTAATAAGG + Intronic
960065620 3:113369073-113369095 AAGGATTTGCTTTATGAATCTGG - Intronic
960163863 3:114380061-114380083 AGATATTGGCTGAATGAAAATGG + Intronic
960364485 3:116754240-116754262 AAGGATTTGTTGACTGAATGTGG - Intronic
960647086 3:119897927-119897949 AAATATTTGCTAAATGAAGATGG + Intronic
960751940 3:120964926-120964948 AAGGACTTGCTGTATGAATCTGG + Intronic
960828127 3:121813759-121813781 AAGAATTTGCTTTATGAATCTGG - Intronic
962696686 3:137955381-137955403 AAGAATTTGCTTTATGAATCTGG + Intergenic
962699445 3:137982315-137982337 AAGGATTTGCTTTATGAATCTGG - Intergenic
962832083 3:139152061-139152083 AAGAACTTGCTTTATGAATATGG - Intronic
962980754 3:140487290-140487312 AAGTATTTTCCAAATAAATATGG - Intronic
963477593 3:145826793-145826815 AAGAATTTGCTTTATGAATTTGG + Intergenic
963560489 3:146858385-146858407 AAGTATTTACTGAAAGCATTAGG + Intergenic
963944831 3:151134523-151134545 AGGTATTTGCAGTATGAGTAGGG + Intronic
964100504 3:152982706-152982728 AAGTACTTGCTTTATGAATCTGG - Intergenic
964183600 3:153915717-153915739 AAGAATTTGCTTTATGAATTTGG - Intergenic
964956981 3:162371747-162371769 TGGTATATGCTGAATGAATATGG + Intergenic
965130209 3:164689119-164689141 TATTATTTGTTGAAAGAATAAGG - Intergenic
965318019 3:167214476-167214498 AAGAACTTGCTTAATGAATCTGG - Intergenic
965385457 3:168040199-168040221 ATATATTTACTGAATGAACAGGG - Intronic
965804992 3:172533307-172533329 AAGTACTTGCTTTATGAATCTGG + Intergenic
965963264 3:174454230-174454252 AAGAATTTGCTTTATGAATCTGG - Intronic
965987022 3:174766713-174766735 AAATATTTGTTAAATAAATAAGG - Intronic
966037076 3:175431998-175432020 AAGTAATAGCTGCATGAATTAGG - Intronic
966111475 3:176407740-176407762 CAGTGTTTGCTGAAGGAATGAGG - Intergenic
966145089 3:176802121-176802143 AAGAACTTGCTTTATGAATATGG - Intergenic
966318359 3:178674063-178674085 AAGTAATTGATGGATGAAGAGGG - Intronic
966336045 3:178869430-178869452 ATGTATTTGCTGAGAGAATGAGG - Intergenic
966367088 3:179201383-179201405 AAGTAATTGCTGAAGCAATCAGG + Exonic
967569672 3:191014198-191014220 AAGTACTTGCTTTATGAATCTGG + Intergenic
967741597 3:193009188-193009210 AAGTATTTGATGAATAAATGGGG + Intergenic
968342688 3:197970659-197970681 AACTATTTGCAGAAACAATATGG - Intronic
969123448 4:4927081-4927103 AAGAATTTGCTTTATGAATCTGG - Intergenic
970055091 4:11962931-11962953 AAGAACTTGCTTAATGAATCTGG + Intergenic
970187844 4:13481947-13481969 AAGTATTTGAGAACTGAATAGGG + Intronic
970685480 4:18561871-18561893 AAGGACTTGCTGTATGAATCTGG - Intergenic
971254899 4:25005585-25005607 AAGTATTTCCTGACTCCATATGG + Intronic
971406957 4:26330326-26330348 TGTTATTTGCTGGATGAATATGG + Intronic
971480371 4:27109383-27109405 AAGTATTTGTTGAATGTCAAGGG - Intergenic
971987741 4:33847965-33847987 AAGTATGTGTTTTATGAATATGG - Intergenic
972083732 4:35186130-35186152 AAGAATTTGCTTTATGAATCTGG - Intergenic
972092367 4:35303283-35303305 ATGTTTTTGCAGAATAAATATGG - Intergenic
972113080 4:35590853-35590875 ATGTCCTTGATGAATGAATAGGG - Intergenic
972386760 4:38574399-38574421 AACTGTTTGATGAATGAATGAGG - Intergenic
972915042 4:43866578-43866600 AAGGATTTGCTGACAGATTAGGG - Intergenic
972943323 4:44223505-44223527 AAGTTTTTACTGATTGAATATGG - Intronic
973556574 4:52089938-52089960 AAGAATTTGCTTTATGAATCTGG + Intronic
973859173 4:55043757-55043779 AAGGATTTGCTTTATGAATCTGG - Intergenic
974005285 4:56550320-56550342 TAGTATTTGCTGCCTGAATAAGG - Intronic
974074900 4:57159650-57159672 AAATATTTGTTGAATGAATGAGG - Intergenic
974200083 4:58625786-58625808 AAGAACTTGCTGTATGAATCTGG - Intergenic
974499047 4:62674078-62674100 AAACATTTCCTGGATGAATAAGG + Intergenic
974578353 4:63760112-63760134 CAGTGTTTGCTACATGAATAAGG + Intergenic
974719180 4:65714956-65714978 AAGGATTTGCTTTATGAATCTGG + Intergenic
974812666 4:66965476-66965498 AAGTATTTGTTGAATATATGTGG - Intergenic
974899489 4:67980004-67980026 AAGGATTTGCTTTATGAATCTGG + Intergenic
974998073 4:69186992-69187014 AAGGATTTGCTTTATGAATCTGG + Intronic
975466093 4:74711607-74711629 AAGAATTTGCTTTATGAATCTGG + Intergenic
975513389 4:75218663-75218685 AAGGATTTGCTTTATGAATCTGG + Intergenic
975567547 4:75775127-75775149 AATTATATACTGAGTGAATAGGG + Intronic
975757092 4:77581618-77581640 ACGTATTTGTTGAATTAAAAAGG - Intronic
975896847 4:79103498-79103520 AAGAATTTGCTTTATGAATCTGG + Intergenic
976257472 4:83113476-83113498 AAATATTTGCTGAATTAAATTGG - Intronic
976467754 4:85389732-85389754 AAGTGTTTGCAAAATGAAAATGG - Intergenic
976799250 4:88970081-88970103 AAATATCTGCTGAATGTATGAGG + Intronic
976916211 4:90378046-90378068 AAATACTTGCCAAATGAATAAGG - Intronic
976918737 4:90410117-90410139 AAGTACTTGCTTTATGAATCTGG - Intronic
976925832 4:90494251-90494273 AAGTACTTGCTTTATGAATCTGG - Intronic
976963535 4:91008566-91008588 AAATATTTGCTGAAAGTAAAAGG - Intronic
976979188 4:91204781-91204803 AAATATTTTCTTAATGAAAAAGG + Intronic
976992112 4:91380402-91380424 AAGGACTTGCTTTATGAATATGG + Intronic
977027473 4:91837428-91837450 GAATATTTGTTGAATCAATATGG + Intergenic
977158561 4:93605571-93605593 TAGTAATAGTTGAATGAATAGGG + Intronic
978148955 4:105411397-105411419 AAGTACTTGCTTTATGAATCTGG - Intronic
978244980 4:106561749-106561771 AAGGATTTGCTTTATGAATGTGG + Intergenic
978269644 4:106873751-106873773 AAGGACTTGCTTTATGAATATGG + Intergenic
978272684 4:106909549-106909571 AAATATTTGATGAAAGAACATGG + Intergenic
978843545 4:113245039-113245061 AAGTTTTTGCTATGTGAATAGGG + Intronic
978905468 4:114000617-114000639 AAATATTAGCTGAATCAAAAGGG + Intergenic
979012899 4:115394034-115394056 AAGGATTTGCTTTATGAATCTGG + Intergenic
979097168 4:116565164-116565186 AAGAATTTGCTTTATGAATATGG - Intergenic
979268075 4:118726531-118726553 AAATATTTGTAGAATGAATGAGG + Intronic
979310746 4:119200148-119200170 AAGTACTTGCTTTATGAATCTGG - Intronic
979370804 4:119883654-119883676 AACTATTTGTTGAATGGATGAGG + Intergenic
979512476 4:121569781-121569803 AAGAATTTGCTTTATGAATCTGG - Intergenic
979630242 4:122893066-122893088 AAATTTATGGTGAATGAATATGG + Exonic
980336123 4:131475695-131475717 AAGAACTTGCTTAATGAATCTGG - Intergenic
980413953 4:132460255-132460277 AAGTACTTGCTTTATGAATCTGG - Intergenic
980460365 4:133102870-133102892 AATTATTTGCTGATTCAAAATGG + Intergenic
980694717 4:136339728-136339750 AAGAAATTGCTTAATGAATCTGG - Intergenic
980769562 4:137353359-137353381 AAGAATTTGCTTTATGAATCTGG - Intergenic
981131814 4:141165284-141165306 AAGAATTTGCTTTATGAATCTGG - Intronic
981160223 4:141488638-141488660 ATGTATTGGATGACTGAATAGGG - Intergenic
981750112 4:148084990-148085012 AAGTACTTGCTTTATGAATCTGG - Intronic
981932253 4:150203292-150203314 AAGTATTTTCTTAATGAAAAGGG - Intronic
982039075 4:151377099-151377121 TAGTATTTGTTTTATGAATATGG - Intergenic
982146534 4:152400796-152400818 AAGTATTTGCAAAATGCACATGG + Intronic
982559236 4:156909048-156909070 CAGTATTTGCTTAGAGAATAAGG + Intronic
983033332 4:162830737-162830759 AAGCATTAGCAGAATGAAAATGG + Intergenic
983364421 4:166767844-166767866 AAGTATTTGCTTTACGAATCTGG + Intronic
983467215 4:168109272-168109294 AAATTTTTGCTGAATAAATATGG - Intronic
983520769 4:168706386-168706408 AATAATATGCTGAAAGAATAAGG + Intronic
983533934 4:168837746-168837768 AAATATTTGTTGAATTAATGAGG - Intronic
983630703 4:169846390-169846412 AAATGTTTGGGGAATGAATAGGG + Intergenic
984176117 4:176419061-176419083 AAGTCACAGCTGAATGAATAAGG - Intergenic
984197858 4:176680648-176680670 ATACATTTGCTGTATGAATACGG - Intergenic
984903211 4:184603153-184603175 AAGAATTTGCTTTATGAATCTGG - Intergenic
1202753039 4_GL000008v2_random:26807-26829 AAGTACTTGCTTTATGAATCTGG - Intergenic
986032588 5:3908381-3908403 AAGTATTTGCTCTTTGAATCTGG - Intergenic
986227475 5:5828984-5829006 GAGTGTCTGCTGAATGCATATGG - Intergenic
986254497 5:6090879-6090901 AAGTATATGCTGCCTGAATATGG + Intergenic
986271964 5:6240074-6240096 AATTATTTTCTGAATAAATTGGG - Intergenic
986789731 5:11148180-11148202 GAGTAACTGCTTAATGAATATGG + Intronic
986807231 5:11319309-11319331 AAGTATTTGTTGAATAAAGAAGG + Intronic
987260660 5:16198892-16198914 AAGAACTTGCTGTATGAATCTGG - Intergenic
987722610 5:21657745-21657767 AAGTATTTGGTCTAAGAATAAGG - Intergenic
987738661 5:21876576-21876598 AAGTAGTGGCAGAATGCATAAGG - Intronic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
988262554 5:28907608-28907630 AAGTATATGCTGTAGTAATATGG - Intergenic
988625195 5:32867680-32867702 AAATATTTGCTGAATTAAGTTGG + Intergenic
988773210 5:34452218-34452240 AAGCATATGCTGTATGGATAGGG - Intergenic
988867464 5:35351710-35351732 AAGAATTTGCTTTATGAATCTGG + Intergenic
988878957 5:35479263-35479285 AAATATTTGTTGAATGAACAAGG + Intergenic
989182655 5:38594004-38594026 AAGTATATGCTAGATGGATAAGG + Intronic
990050805 5:51497454-51497476 AAGTACATGCTGAATGAGTTTGG - Intergenic
990084203 5:51954216-51954238 AAGTACTTGCTTTATGAATCTGG - Intergenic
990095804 5:52110851-52110873 AATCATTAACTGAATGAATAAGG - Intergenic
990285203 5:54294465-54294487 AAGTATTTGCTGAGTAAGGAAGG + Intronic
990556153 5:56938211-56938233 AAATACTTGTTGAATGACTATGG + Intronic
991346738 5:65676423-65676445 AAGTACTTGCTTTATGAATCTGG - Intronic
991637117 5:68717155-68717177 AAGAATTTGCTTTATGAATCTGG + Intergenic
992038635 5:72806822-72806844 AAGAATTTGCTTTATGAATCTGG + Intergenic
992048429 5:72921462-72921484 AAATATTTGTTGAATGAATGAGG + Intergenic
992284274 5:75217374-75217396 AAGAACTTGCTTTATGAATATGG + Intronic
992320412 5:75608120-75608142 AAGTATTTGTCAAATAAATATGG - Intergenic
992646327 5:78814969-78814991 AAGTATTTGTTGAATATATAAGG + Intronic
992996702 5:82340903-82340925 TAATGTTTGCTGAATAAATACGG + Intronic
993114577 5:83704741-83704763 AAGAATTTGCTTTATGAATCTGG - Intronic
993271243 5:85799451-85799473 ATATATTTGCTGAAACAATATGG - Intergenic
993561375 5:89415017-89415039 AAGTATTTGTTTAATAAATGAGG + Intergenic
993635991 5:90344148-90344170 AAATATTTGTTGGATGAATGTGG + Intergenic
993793409 5:92235787-92235809 AAGAATTTGCTTTATGAATCTGG + Intergenic
993986536 5:94603913-94603935 AAGTACTTGCTTTATGAATCTGG - Intronic
994169409 5:96642314-96642336 AAATATTTGTTAAATGGATAAGG + Intronic
994284981 5:97954346-97954368 ATGTAATTGCTGAAGGGATATGG - Intergenic
994435425 5:99724441-99724463 AAATTATTGCTGAATGAATATGG + Intergenic
994770628 5:103976683-103976705 AAATATTTGCTTTATGAATCTGG - Intergenic
994803662 5:104414706-104414728 TAGTATTTGTTTAATGAATCTGG - Intergenic
994872925 5:105377124-105377146 AAGTATTTGTTTTATGAATCTGG + Intergenic
994970730 5:106733097-106733119 AAGAACTTGCTTTATGAATATGG - Intergenic
995054132 5:107740654-107740676 TGATATTTGTTGAATGAATATGG - Intergenic
995410430 5:111851220-111851242 AAATATTTGTTGAATAAAAAAGG - Intronic
995642741 5:114276484-114276506 AAGAATTTGCTTTATGAATCTGG + Intergenic
995660688 5:114479398-114479420 AAGTACTTGCTTTATGAATCTGG - Intronic
995695059 5:114869240-114869262 AAGTACTTGCTTTATGAATCTGG - Intergenic
995903699 5:117098471-117098493 AACAATTTGCTGAAGGAAGAAGG - Intergenic
995983150 5:118132921-118132943 AAGAACTTGCTTTATGAATATGG + Intergenic
996140158 5:119897241-119897263 AAATACTTGAAGAATGAATAGGG + Intergenic
996147067 5:119989797-119989819 AAGGACTTGCTGTATGAATCTGG + Intergenic
996163344 5:120194781-120194803 AAGAATTTGCTTTATGAATCTGG - Intergenic
996272481 5:121623536-121623558 AAATATTTGTTAAATAAATAAGG - Intergenic
996699945 5:126440275-126440297 AAGTATTTCTTAAATGTATAAGG + Intronic
997100520 5:130963600-130963622 AGGAATTTGCTGAACGATTATGG + Intergenic
997304480 5:132827653-132827675 AAATATTTGCTGAATGTCAAGGG + Intronic
998017182 5:138741702-138741724 AAATATTTGCTGAAAGAATATGG - Intronic
998673665 5:144382538-144382560 CAGTATTGAATGAATGAATATGG + Intronic
998754020 5:145356423-145356445 AAGAATTTGCTTTATGAATCTGG + Intergenic
999139479 5:149348724-149348746 AAATATTTGTTGAATGAGTGAGG + Intronic
999170507 5:149590130-149590152 AAATACTTGTTGAATGAATGTGG + Intronic
999553074 5:152711192-152711214 AACTATTTGTTGAGTGATTAAGG - Intergenic
999666133 5:153915788-153915810 AAGAATTTGCTTTATGAATCTGG + Intergenic
999697389 5:154199048-154199070 AAATATTTGCTGAATGGCTGAGG + Intronic
999872157 5:155764046-155764068 AAGTATTTGTTGAACAAAGAAGG - Intergenic
999943661 5:156571890-156571912 AAGTGATTGCTGAATGGATATGG - Intronic
1000030054 5:157393766-157393788 AAGCCTTTCCTGAAGGAATAAGG - Intronic
1000153386 5:158526091-158526113 AAGTACTTTCTCAATGTATAAGG - Intergenic
1000529536 5:162402130-162402152 AAGTATTTCTTGAATGACAAAGG + Intergenic
1000589485 5:163141656-163141678 AAGTAGTTGCTTTATGAATCTGG + Intergenic
1000630478 5:163585370-163585392 AAATATTTGTGGAATGAATGTGG + Intergenic
1000776865 5:165430462-165430484 ATGTATTTGTTGAATAAATGAGG - Intergenic
1001865145 5:175097558-175097580 AAGCAGATGCTGGATGAATATGG + Intergenic
1002321578 5:178379248-178379270 AAGTTTTGGTTAAATGAATAAGG - Intronic
1002747180 6:68774-68796 TAGTATTTGCTTTATGAATCTGG - Intergenic
1003066322 6:2906253-2906275 AAACCTTTGCAGAATGAATAGGG - Intergenic
1003542388 6:7029313-7029335 AAGGATTTGCTTTATGAATCTGG - Intergenic
1004521854 6:16368577-16368599 CAGTATCTGCTAAATGAATACGG + Intronic
1004561060 6:16751276-16751298 AAGTGTCAGCTGAATGAAAAAGG - Intronic
1004890877 6:20099281-20099303 AAGTGTTTGTTGAATGAATGAGG - Intergenic
1005188664 6:23192656-23192678 AAATGTTTGCTGAATAAATATGG + Intergenic
1005631270 6:27710508-27710530 AAGCATTTGTTAAATGAATAAGG + Intergenic
1007137044 6:39532385-39532407 AATTATTTGTTGAATGAAAGAGG + Intronic
1007320697 6:41027118-41027140 AAGTATCTGCTGACTGAATGGGG + Exonic
1007815344 6:44520297-44520319 TAGTATTTGCTTTATGAATCTGG + Intergenic
1008273317 6:49515313-49515335 AAATACTTGCTGAATGAATCAGG - Intronic
1008375957 6:50792167-50792189 AACTAGTTGTTGAATGGATATGG - Intergenic
1008518113 6:52337331-52337353 AAGCATTTGTTAAATGAATGAGG - Intergenic
1008557303 6:52685813-52685835 AAATGTTCGCTAAATGAATAAGG - Intronic
1008744602 6:54654452-54654474 TAGTATTTGCCAAATGAACATGG + Intergenic
1008884710 6:56419823-56419845 AAGTATTTATTGAATGAATGAGG - Intergenic
1008973575 6:57398800-57398822 AAGAACTTGCTGTATGAATCTGG + Intronic
1009051912 6:58285888-58285910 AAGTATATGCTCAAAGAATATGG + Intergenic
1009054559 6:58318900-58318922 AAGAACTTGCTTTATGAATATGG - Intergenic
1009162472 6:60300352-60300374 AAGAACTTGCTGTATGAATCTGG + Intergenic
1009349634 6:62658992-62659014 AAATAATTGCTGAATGGATGAGG + Intergenic
1009495644 6:64343042-64343064 AAGTACTTGCTTTATGAATCTGG - Intronic
1009597013 6:65748368-65748390 AAGAATTTGCTTTATGAATATGG - Intergenic
1009701526 6:67188841-67188863 AAGTTTTCTCTGAATGTATAAGG - Intergenic
1009818655 6:68770889-68770911 AAATATTTTCTGAATAAATGAGG - Intronic
1009837533 6:69023172-69023194 AAGCCTTTGCTGAATGACTCAGG + Intronic
1009849368 6:69176140-69176162 AAGTACTTGCTGGATAAATCAGG - Intronic
1009897924 6:69776121-69776143 AAATATTTTCCAAATGAATAAGG + Intronic
1010227127 6:73501204-73501226 TAGTATTAGCTGAATGATTCTGG - Intronic
1010297805 6:74220941-74220963 AAGGACTTGCTGTATGAATCTGG + Intergenic
1010411288 6:75564922-75564944 AAGTACTTGCTTTATGAATCTGG - Intergenic
1010691711 6:78918692-78918714 AAGTATTTGTTTTATGAATCTGG - Intronic
1010844286 6:80685692-80685714 AAGGATTTGCTTTATGAATCTGG - Intergenic
1010912885 6:81581022-81581044 AAGGATTTGCTTTATGAATCTGG - Intronic
1011076356 6:83443625-83443647 AAATATTTGTTGAATGAATGTGG - Intergenic
1011227506 6:85123806-85123828 AAGTATATATTGAATGAATGAGG + Intergenic
1011763976 6:90599156-90599178 GAATATTTGCAGACTGAATATGG - Intergenic
1011807059 6:91083766-91083788 AAGTATTTATTGAATGACTATGG - Intergenic
1012484421 6:99704629-99704651 AAGGATTTGCTTTATGAATCTGG - Intergenic
1012492029 6:99792697-99792719 AAGTATTTACCAAATAAATAAGG + Intergenic
1012556087 6:100513559-100513581 AATTTTTTTCTGAATAAATAGGG - Intronic
1012697138 6:102400197-102400219 AATTATTTGCTGACTTAACATGG + Intergenic
1012922160 6:105231661-105231683 AAGAATTTGCTTTATGAATCTGG + Intergenic
1012935397 6:105362770-105362792 AAGTACTTGGGGAATAAATATGG + Intronic
1013265042 6:108488180-108488202 AAATATTTGGTGGATGATTAGGG - Intronic
1013490535 6:110642373-110642395 CAATATTTGTTGAATGAATGAGG - Intronic
1013909125 6:115252558-115252580 AAGGACTTGCTTTATGAATATGG - Intergenic
1014117871 6:117686624-117686646 CAGTTATTTCTGAATGAATATGG + Intronic
1014118228 6:117690449-117690471 AAATGTCTGCTGAAAGAATATGG - Intronic
1014295366 6:119611014-119611036 AAGTGTCTGATGAATGAATTAGG - Intergenic
1014853844 6:126375048-126375070 AAATGTCTGCTGAATGAATGAGG - Intergenic
1015169607 6:130237795-130237817 AAGTATTACCTGAATCAATTTGG - Intronic
1015198968 6:130557278-130557300 ATGTATTTGCCCAATGAATCAGG - Intergenic
1015210429 6:130691636-130691658 AAGTACTTGTTGTATGAATCTGG - Intergenic
1015495064 6:133872902-133872924 AAATATTTGCTAAATGAAAAAGG + Intergenic
1015541293 6:134316903-134316925 AATTATTGGCTGAATGGATTTGG + Intronic
1016099622 6:140082462-140082484 AAATATTTACTAAATAAATATGG + Intergenic
1016281148 6:142420368-142420390 TATTATTTCATGAATGAATATGG + Intronic
1016338284 6:143032883-143032905 AAGTACTTGCTTTATGAATCTGG + Intergenic
1016463453 6:144302571-144302593 AACCATTTGCTGAATGAATGAGG - Intronic
1017043820 6:150328928-150328950 AAGTGTTTGCTGAAGGCTTAGGG - Intergenic
1017067009 6:150538541-150538563 AAGAATGTGCTCAGTGAATAGGG - Intergenic
1017268354 6:152477751-152477773 AGATATTTGTTGAAAGAATAGGG + Intronic
1017303119 6:152885127-152885149 AAGGATTTGCTTTATGAATCTGG - Intergenic
1017994272 6:159518716-159518738 AAGAATTTGCTTTATGAATCTGG + Intergenic
1018073112 6:160183866-160183888 AAGGATTTGCTTTATGAATCTGG - Intronic
1018159589 6:161025415-161025437 AAGTATTTGGTGACGGAAAACGG - Intronic
1020391154 7:7659956-7659978 AAGAACTTGCTGTATGAATCTGG + Intronic
1020443321 7:8241902-8241924 AAGGATTTGCTTTATGAATCTGG - Intronic
1020487416 7:8736781-8736803 AAAAATTTGCTTTATGAATATGG + Intronic
1021110142 7:16684508-16684530 AAGTATATTTTAAATGAATATGG + Intronic
1021282467 7:18737914-18737936 AAGGACTTGCTGTATGAATCTGG + Intronic
1021870322 7:24999901-24999923 AAGGATTTGCTTTATGAATCTGG + Intergenic
1021951296 7:25777634-25777656 AAGCATATGATGAATAAATAAGG + Intergenic
1023601408 7:41885087-41885109 AAATATTTCCAGAATGAATGAGG - Intergenic
1023916547 7:44593889-44593911 AAATATTTGTTGAATGAATATGG + Intergenic
1024372663 7:48604882-48604904 AAGAATTTGCTTTATGAATCTGG + Intronic
1024622142 7:51169740-51169762 AAGTATATAAAGAATGAATAAGG + Intronic
1024950263 7:54853656-54853678 AAGGATTTGCTTTATGAATCTGG + Intergenic
1025146511 7:56510065-56510087 AAGGATTTGCTTCATGAATCTGG + Intergenic
1025273971 7:57557346-57557368 AAGTATGTGTTTTATGAATATGG - Intergenic
1025717046 7:63968532-63968554 AAGAATTTGCTTTATGAATCTGG - Intergenic
1026032878 7:66810053-66810075 AGAGATTTGCTGAATGAATGAGG - Exonic
1027561476 7:79736973-79736995 ATTTATTTGCTGTATAAATATGG + Intergenic
1028130250 7:87163024-87163046 AAGGGTTTTCTGGATGAATAGGG + Intronic
1028185671 7:87783104-87783126 AAGTACTTGCTTTATGAATCTGG + Intronic
1028367127 7:90046586-90046608 CAGTATTTGTTGAATGAAAGTGG - Intergenic
1028414290 7:90563613-90563635 AAATGTTTGTTGAATGAATTTGG - Intronic
1028640102 7:93032280-93032302 AAGAATTTGCTTTATGAATCTGG - Intergenic
1028658298 7:93236071-93236093 AAATATTTGTTGCATGAATGTGG + Intronic
1029006301 7:97213694-97213716 AAGGATTTGCTTTATGAATCTGG + Intergenic
1029367213 7:100124352-100124374 AAATGTTTGTTGAATGAATGAGG + Intronic
1029552741 7:101246213-101246235 AAATATTTGTTGAATAAACACGG + Intronic
1030569384 7:111203222-111203244 AAATGTTTATTGAATGAATATGG - Intronic
1030938904 7:115620348-115620370 AAGTAATTGCTGTAAGAAAAAGG + Intergenic
1031003520 7:116445478-116445500 AATTATTTGATGAATGGATAAGG - Intronic
1031046442 7:116893597-116893619 CAGTATTAACTGAATGTATAAGG - Intronic
1031062920 7:117072138-117072160 AAGTATTTGGTGTAGTAATAGGG + Intronic
1031115180 7:117659431-117659453 AAATATTGGTTGAATGAATAAGG + Intronic
1031613508 7:123854876-123854898 AAGAATTTGCTTTATGAATCTGG + Intronic
1031810536 7:126362446-126362468 AAGTAGTTGGTGACTGATTAGGG + Intergenic
1031830124 7:126615861-126615883 AAGTACTTGCTTTATGAATCTGG - Intronic
1031835669 7:126679081-126679103 CAGTCTTTACTGAATTAATAAGG - Intronic
1032586888 7:133155037-133155059 AAGCATTTGCTGATAGAATGTGG + Intergenic
1032622519 7:133550914-133550936 AACTTTTTGCTGACTGAATTGGG - Intronic
1032642495 7:133785532-133785554 AAGTATGTGCTTAGTGAAAAAGG - Intronic
1032670945 7:134081916-134081938 AAATATTTTTTGAATGTATAAGG - Intergenic
1032729681 7:134627290-134627312 AAGTGATTGCTTAGTGAATAGGG - Intergenic
1032823930 7:135551075-135551097 AAAAGTTTTCTGAATGAATAAGG - Intergenic
1033102686 7:138489003-138489025 AAGGACTTGCTGTATGAATCTGG + Intronic
1033532755 7:142281898-142281920 TTGTATTTCCTGAATGAATCTGG + Intergenic
1033667587 7:143457207-143457229 AAATATTTGTTGAATGAATGAGG - Intergenic
1033683538 7:143619764-143619786 AAATATATGCTAAATAAATAAGG - Intergenic
1033701075 7:143837874-143837896 AAATATATGCTAAATAAATAAGG + Intergenic
1033713177 7:143970950-143970972 AAATATTTGTTGAACAAATATGG - Intergenic
1033961333 7:146917459-146917481 AAGTAATTGTTGTATAAATATGG + Intronic
1034049034 7:147962174-147962196 AAATTTTTGTTGAATTAATAAGG + Intronic
1034314744 7:150119570-150119592 AAGAATTTGCTTTATGAATCTGG - Intergenic
1035147154 7:156830678-156830700 AAACATTTGCTGCATGAATTAGG + Intronic
1035203983 7:157282654-157282676 AAATGTTTGTTGAATGAACAAGG + Intergenic
1035463582 7:159061706-159061728 AAATACTTGCTGAATGAGTAAGG - Intronic
1035780639 8:2224626-2224648 AAATATTTGTTAAATGGATACGG - Intergenic
1035794309 8:2339381-2339403 AAGAATTTGCTTTATGAATCTGG - Intergenic
1037079226 8:14762511-14762533 TAGTAAGTACTGAATGAATAGGG + Intronic
1037300361 8:17445062-17445084 TAGTATTTGTTGAATGATTGTGG + Intergenic
1037398568 8:18469397-18469419 AAGTACTTGCTTTATGAATCTGG - Intergenic
1037529778 8:19761585-19761607 TAATATTTGCTGACTGAAAAGGG + Intergenic
1037711457 8:21358582-21358604 AAGAATTGGCTCAATGATTATGG + Intergenic
1037828286 8:22173151-22173173 AAGTATTTGCTGAAGAATGATGG + Intronic
1038115426 8:24548606-24548628 CAGTATCTGCAGAAAGAATAAGG - Intergenic
1038265755 8:26039175-26039197 AAACATTTGTTGAAAGAATAAGG + Intronic
1038569327 8:28646917-28646939 TAGTGTATGCTGAATGAATGGGG - Intronic
1038962946 8:32541799-32541821 TGGCATTTGCTGTATGAATATGG + Intronic
1039285073 8:36030547-36030569 AAGAACTTGCTGTATGAATCTGG - Intergenic
1039713311 8:40081502-40081524 AGGCATTTTCTGAATTAATATGG - Intergenic
1039992471 8:42500742-42500764 AAATATTTGATTAATGGATATGG - Intronic
1040595857 8:48836944-48836966 AAGTAGATGCTCAATAAATATGG - Intergenic
1040814673 8:51494766-51494788 AAGTACTTGCTTTATGAATCTGG - Intronic
1040827390 8:51638687-51638709 AAGTACTTGCTTCATGAATCTGG - Intronic
1040893002 8:52336925-52336947 AAATATTTTATGAATGACTAAGG - Intronic
1041051062 8:53934596-53934618 AAGAACTTGCTTTATGAATATGG - Intronic
1041423808 8:57697659-57697681 AAGAATTTGCTTTATGAATCTGG - Intergenic
1041901094 8:62983444-62983466 AAGTGTTTGTTGAATGCTTAGGG - Intronic
1042259836 8:66846981-66847003 AAGTGTTCACTGAATGAATTAGG - Intronic
1042380560 8:68108492-68108514 AAGTGTATACTGAATGAAAATGG + Intronic
1042479064 8:69282664-69282686 AAGAACTTGCTTAATGAATCTGG - Intergenic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1042818818 8:72908112-72908134 AAATATCTGCTGAAAGAATCAGG - Intronic
1042892850 8:73632385-73632407 AAGTATTTGAGGAATCAACATGG + Intronic
1042949055 8:74182228-74182250 AAGGATTTGCTGAATCAAAAGGG - Intergenic
1043191972 8:77236591-77236613 AAAAATTTGCTGAATAAATAAGG - Intergenic
1043467411 8:80525694-80525716 AAGTATTTATTGAATGAGTTTGG - Exonic
1043490985 8:80748912-80748934 AAGTATTTGTTAAATGAACCAGG - Intronic
1043648325 8:82553086-82553108 AAAAATTTTCTGAATGAATATGG + Intergenic
1043697110 8:83233395-83233417 AAGGACTTGCTTTATGAATATGG - Intergenic
1043789607 8:84447625-84447647 AAATATTTATTGAATGACTACGG + Intronic
1043806940 8:84683497-84683519 AAGGATTTGCTTTATGAATCTGG + Intronic
1043819185 8:84841454-84841476 AAGGACTTGCTGTATGAATCTGG - Intronic
1043881616 8:85549760-85549782 ATGGATTTGCTGCATGAATGTGG + Intergenic
1043885039 8:85589178-85589200 AAATATTTATTAAATGAATAAGG - Intergenic
1043947336 8:86269241-86269263 AACTATTTGATGAAAGAATGAGG + Intronic
1044162211 8:88933854-88933876 AAGAATTTGCTTTATGAATCTGG + Intergenic
1044225235 8:89710660-89710682 AAGGACTTGCTGTATGAATCTGG - Intergenic
1044308274 8:90663512-90663534 AAGTACTTGTTGTATGAATCTGG + Intronic
1044325640 8:90854644-90854666 GAGTATTTGCTCACTGAACAAGG - Intronic
1044450701 8:92333174-92333196 AAGAATTTGCTTTATGAATCTGG + Intergenic
1044458295 8:92414698-92414720 CAGTACATGCAGAATGAATAGGG - Intergenic
1044546805 8:93468806-93468828 AAGGATTTGCTTTATGAATCTGG - Intergenic
1044548506 8:93485711-93485733 AAGGATTTGCTTTATGAATCTGG - Intergenic
1044876177 8:96669002-96669024 CAGTCTTTGCTGAATACATAAGG - Intronic
1045156271 8:99476424-99476446 AAGAATTTGCTTACTGCATATGG - Intronic
1045184916 8:99828225-99828247 AAGAACTTGCTTTATGAATATGG + Intronic
1045969292 8:108061521-108061543 AAGGATTTGCTTTATGAATCTGG - Intronic
1046110991 8:109724411-109724433 AAGTATTTGTTTAATGAATCTGG - Intergenic
1046338653 8:112823976-112823998 AAGAATTTGTTGTATGAATCTGG + Intronic
1046480059 8:114804550-114804572 AAGAATGTGCTTAACGAATAAGG - Intergenic
1046712772 8:117530387-117530409 AAATATTTGCTGATTGAGTAGGG + Intronic
1046864607 8:119132347-119132369 AAGAATTTGGTCACTGAATAGGG - Intergenic
1046972275 8:120236270-120236292 AAGAATTTGCTTTATGAATCTGG + Intronic
1048057423 8:130881236-130881258 AAATACTTGTTGAATGAATAAGG - Intronic
1048178581 8:132174552-132174574 AAATATTTGTTGACTGACTAAGG - Intronic
1048816139 8:138335593-138335615 AAGTACTTGCTTTATGAATCTGG - Intronic
1049937842 9:516730-516752 AAATACTTGTTGAATGAATATGG + Intronic
1050322682 9:4469122-4469144 AAGGACTTGCTTAATGAATCTGG - Intergenic
1050329763 9:4533550-4533572 AAGGATTTGCTTTATGAATCTGG - Intronic
1050939642 9:11442724-11442746 AAGTATCTTCTGACTGCATAGGG + Intergenic
1050959660 9:11712355-11712377 AAGTATTAGCTTATTGATTAAGG + Intergenic
1051030675 9:12672528-12672550 AACTATTTGTTAAATGAATTGGG - Intergenic
1051356776 9:16246678-16246700 AAGTCTTTGGGGAATGAAGAAGG + Intronic
1052010031 9:23396681-23396703 AAGGATTTGCTTTATGAATCTGG - Intergenic
1052724670 9:32215483-32215505 AAGTACTTGCTTTATGAATCTGG + Intergenic
1052800271 9:32960296-32960318 AAGGATTTGCTTTATGAATCTGG - Intergenic
1052885254 9:33640358-33640380 AAGCATTTGCGGAATCAAAATGG - Intergenic
1053405974 9:37876285-37876307 AAGTAATTGCTTAATAAAGAGGG + Intronic
1053564707 9:39236930-39236952 AAATGTTTCCTGAATGAATGAGG - Intronic
1053720661 9:40943624-40943646 AAGTTTTGGCTGAATAAATTAGG - Intergenic
1053830488 9:42074831-42074853 AAATGTTTCCTGAATGAATGAGG - Intronic
1054132445 9:61382104-61382126 AAATGTTTCCTGAATGAATGAGG + Intergenic
1054345326 9:63908531-63908553 AAGTTTTGGCTGAATAAATTAGG + Intergenic
1054600071 9:67112624-67112646 AAATGTTTCCTGAATGAATGAGG + Intergenic
1054990652 9:71321764-71321786 AAGTATTTGCTGAATGAATAAGG - Intronic
1055014234 9:71598302-71598324 AAGGATTTGCTTTATGAATCTGG - Intergenic
1055124925 9:72707997-72708019 CAACATTTGTTGAATGAATAGGG + Intronic
1055170124 9:73247068-73247090 CAGTGTGTGCTGAATCAATAGGG + Intergenic
1055602454 9:77933948-77933970 AAGTATTTGCAGGGTTAATAAGG - Intronic
1055796612 9:79981424-79981446 GAGTATTTGTTGCATGAAAAGGG + Intergenic
1056306622 9:85297024-85297046 TACTATTTGCTGTCTGAATATGG + Intergenic
1056701119 9:88909442-88909464 AAGTACTTGCTTTATGAATCTGG - Intergenic
1057175705 9:92997130-92997152 AAGGACTTGCTTTATGAATATGG + Intronic
1057449670 9:95145859-95145881 AATTATTTGTTGAAATAATACGG - Intronic
1057598026 9:96433220-96433242 AAATATTTGTCGAATAAATAGGG - Intergenic
1057866437 9:98685485-98685507 ATATACTTGTTGAATGAATAAGG + Intronic
1058398424 9:104583670-104583692 AAATATTTTGTGAATGAATAAGG + Intergenic
1058460842 9:105181098-105181120 AAGTCTGTGCTGAAAGAATTGGG - Intergenic
1058488967 9:105474549-105474571 ACCTACTTGCTGACTGAATAGGG + Intronic
1058534840 9:105948238-105948260 AAGAACTTGCTTAATGAATCTGG + Intergenic
1058600633 9:106666064-106666086 AAATATTGGTTGAATGAATGAGG + Intergenic
1059432287 9:114257463-114257485 AGGAATCTGCTGAATGAACAAGG - Intronic
1060115994 9:120941288-120941310 GAGGATTTGCTGAAGGAATCAGG - Intergenic
1060514285 9:124256258-124256280 TAATGTTTGCTGCATGAATATGG + Intergenic
1203533828 Un_KI270743v1:11512-11534 AAGTACTTGCTTTATGAATCTGG - Intergenic
1186217156 X:7312457-7312479 AAGAACTTACTGAATGAGTAGGG + Intronic
1186309691 X:8304089-8304111 AAGTATTTGGGGAATGAAGCTGG - Intergenic
1186388721 X:9136733-9136755 AAGTCTTTGCAGAACGAGTAGGG - Intronic
1186505493 X:10088602-10088624 AAGTTTTTGTTGGATGAAAATGG + Intronic
1186903252 X:14081661-14081683 AAGAATTTGCACAATGAAAACGG - Intergenic
1186956849 X:14691984-14692006 AGGTATTTGCAGCATTAATAGGG - Intronic
1187779437 X:22801889-22801911 ATGTATTTGAAGAATAAATATGG - Intergenic
1188171662 X:26935349-26935371 AAATATTTGTTGAAAGAATGAGG + Intergenic
1188436978 X:30172042-30172064 AAGTACCTGCTGAATTAATGAGG + Intergenic
1188491827 X:30745967-30745989 AGATATTTGCTGAATGAATACGG + Intergenic
1188806733 X:34600087-34600109 AAGTACTTGCTTTATGAATCTGG + Intergenic
1189017454 X:37299099-37299121 AAGGACTTGCTGTATGAATCTGG + Intergenic
1189878323 X:45461064-45461086 AAGTACTTGTTTTATGAATATGG + Intergenic
1190476687 X:50835075-50835097 AAATATTTTTTGAATGAATGTGG + Intergenic
1190621804 X:52294257-52294279 AAGTACTTGCTTTATGAATCTGG - Intergenic
1190807414 X:53852100-53852122 AAGGACTTGCTTAATGAATCTGG + Intergenic
1191133058 X:57035693-57035715 AAGAACTTGCTGTATGAATCCGG + Intergenic
1191134739 X:57051390-57051412 AAGGATTTGCTTTATGAATCTGG - Intergenic
1191181769 X:57571638-57571660 AAGAATTTGCTTTATGAATCTGG - Intergenic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1191702761 X:64061147-64061169 AAGGACTTGCTGTATGAATCTGG + Intergenic
1191733710 X:64366092-64366114 AAGTACTTGCTTTATGAATCTGG - Intronic
1191774283 X:64795735-64795757 AAGTACTTGTTTTATGAATATGG - Intergenic
1192245064 X:69365232-69365254 TAGTATGTGCTCAATAAATATGG + Intergenic
1192334016 X:70202480-70202502 CCGTAACTGCTGAATGAATAAGG - Intronic
1192839808 X:74843127-74843149 AAGAACTTGCTTTATGAATATGG + Intronic
1192912426 X:75618864-75618886 AAGGATTTGCTTTATGAATCTGG - Intergenic
1192984500 X:76382165-76382187 AAGAATTTGCTCTATGAATCTGG - Intergenic
1193079598 X:77392680-77392702 AAGAATTTGCTTTATGAATCTGG - Intergenic
1193171295 X:78339439-78339461 AAGAACTTGCTTAATGAATCTGG + Intergenic
1193173642 X:78366293-78366315 TAGTATTTACTGAGTAAATATGG + Intergenic
1193452365 X:81686405-81686427 AAGGACTTGCTGTATGAATCTGG - Intergenic
1193542691 X:82790800-82790822 AAGGATTTGCTTTATGAATCTGG - Intergenic
1193778913 X:85678942-85678964 AAGTACTTGTTGGATGATTAAGG - Intergenic
1193853851 X:86573827-86573849 AAGTATTTGCAGCCTGAGTAGGG - Intronic
1194026746 X:88762514-88762536 AAGAACTTGCTTTATGAATATGG + Intergenic
1194212904 X:91090707-91090729 AAGAACTTGCTTAATGAATCTGG + Intergenic
1194287047 X:92022516-92022538 AAGTACTTGCTTTATGAATCTGG - Intronic
1194621015 X:96172038-96172060 AAATGTTTATTGAATGAATAAGG - Intergenic
1194766716 X:97850262-97850284 AAATATTTGTTAAATGACTAAGG - Intergenic
1194862867 X:99025822-99025844 AAGTATTTACTTTATGCATAGGG + Intergenic
1194934766 X:99935768-99935790 AAGTAATTGTTTAATGAATTTGG + Intergenic
1195854731 X:109318539-109318561 AAGAACTTGCTTAATGAATCTGG + Intergenic
1195921068 X:109984246-109984268 AAGCAACTGATGAATGAATAAGG + Intergenic
1196272914 X:113733650-113733672 AAGAACTTGCTGTATGAATCTGG + Intergenic
1196610553 X:117709481-117709503 AAGTATTTTCAGACTGAAGATGG - Intergenic
1196776156 X:119339733-119339755 AAATATTTGCTGATTGATCAAGG - Intergenic
1197062599 X:122199298-122199320 AGGTGTTTGCTGAATGCAAAGGG - Intergenic
1197399449 X:125972434-125972456 AAGAATTTGCTTTATGAATCTGG + Intergenic
1197405430 X:126042140-126042162 AGGTGTTTGCTGAATGCAAAGGG + Intergenic
1197474416 X:126902979-126903001 AAGAACTTGCTTAATGAATCTGG - Intergenic
1197578941 X:128257447-128257469 AAGTACTTGCTTTATGAATTTGG - Intergenic
1197634294 X:128897318-128897340 AATTATTTGTTGAATGAATAAGG - Intergenic
1198145654 X:133854378-133854400 AAATATTTGTTAAATGGATATGG - Intronic
1198592637 X:138200759-138200781 AAGTACTTGCTTTATGAATCTGG - Intergenic
1198834388 X:140786240-140786262 AAATATTTGTTGAATGAATGAGG - Intergenic
1199007545 X:142719731-142719753 AAGAACTTGCTTTATGAATATGG - Intergenic
1199345040 X:146729111-146729133 AAGTATTTGGTGAAAAAATATGG - Intergenic
1199621341 X:149704441-149704463 AAATATTTTCTGAATGAAGCAGG - Intronic
1200020947 X:153207238-153207260 AACTATTTGTTGAGTGAATAGGG + Intergenic
1200318063 X:155155337-155155359 TAATATTTGCTGAATGAATGTGG - Intergenic
1200790517 Y:7295362-7295384 AAGTCCTTGCTAAATGGATAGGG + Intergenic
1200956003 Y:8946701-8946723 AAGGATTTGCTTTATGAATCTGG + Intergenic
1201229295 Y:11847810-11847832 AAGAACTTGCTTTATGAATATGG - Intergenic
1201524366 Y:14915032-14915054 AAGTACTTGCTTTATGAATCTGG + Intergenic
1201553419 Y:15242888-15242910 ATGAATTTGCTGAGTGAAAATGG + Intergenic
1201582908 Y:15529904-15529926 AAGGATTTGCTTTATGAATCTGG + Intergenic
1201587509 Y:15577236-15577258 AAGAATCTACTGAATGAATAGGG + Intergenic
1201650602 Y:16280829-16280851 AAGTATGTTTTGAATGAGTAGGG - Intergenic
1201956335 Y:19627796-19627818 AAGGACTTGCTGAATGAATCTGG + Intergenic