ID: 1054991976

View in Genome Browser
Species Human (GRCh38)
Location 9:71338350-71338372
Sequence CTTCAGAGGGAAATGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054991971_1054991976 1 Left 1054991971 9:71338326-71338348 CCTGCTGGAATAACGTTCAACGC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG No data
1054991968_1054991976 29 Left 1054991968 9:71338298-71338320 CCAAGATGATCTGCCAGTAATTT 0: 1
1: 1
2: 2
3: 16
4: 178
Right 1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG No data
1054991969_1054991976 16 Left 1054991969 9:71338311-71338333 CCAGTAATTTAATCGCCTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054991976 Original CRISPR CTTCAGAGGGAAATGGCGGA AGG Intronic
No off target data available for this crispr