ID: 1054992206

View in Genome Browser
Species Human (GRCh38)
Location 9:71341580-71341602
Sequence TTGAATGCTCAATAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054992202_1054992206 18 Left 1054992202 9:71341539-71341561 CCGTTCAAAATTGCTAAGGTTAC 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1054992206 9:71341580-71341602 TTGAATGCTCAATAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054992206 Original CRISPR TTGAATGCTCAATAGGAGAA GGG Intronic
No off target data available for this crispr