ID: 1055000746

View in Genome Browser
Species Human (GRCh38)
Location 9:71446817-71446839
Sequence TCTCATGGGGAAGAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 353}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055000746_1055000754 -2 Left 1055000746 9:71446817-71446839 CCCTCCACTTCTTCCCCATGAGA 0: 1
1: 0
2: 2
3: 32
4: 353
Right 1055000754 9:71446838-71446860 GAAGTTCGCCTCCCTCGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1055000746_1055000753 -3 Left 1055000746 9:71446817-71446839 CCCTCCACTTCTTCCCCATGAGA 0: 1
1: 0
2: 2
3: 32
4: 353
Right 1055000753 9:71446837-71446859 AGAAGTTCGCCTCCCTCGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 58
1055000746_1055000752 -7 Left 1055000746 9:71446817-71446839 CCCTCCACTTCTTCCCCATGAGA 0: 1
1: 0
2: 2
3: 32
4: 353
Right 1055000752 9:71446833-71446855 CATGAGAAGTTCGCCTCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 84
1055000746_1055000761 28 Left 1055000746 9:71446817-71446839 CCCTCCACTTCTTCCCCATGAGA 0: 1
1: 0
2: 2
3: 32
4: 353
Right 1055000761 9:71446868-71446890 CCAGCGCCGAGCGCTCTCGCTGG 0: 1
1: 0
2: 1
3: 5
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055000746 Original CRISPR TCTCATGGGGAAGAAGTGGA GGG (reversed) Intronic
900694769 1:4002843-4002865 TCACATGGGGAAGAGGAGGCAGG + Intergenic
901200797 1:7466284-7466306 TTTCATGGGCAAGAATTGCAAGG + Intronic
901559143 1:10056034-10056056 TCCCAGGGGATAGAAGTGGATGG - Intronic
901703258 1:11056589-11056611 CCCCATGGGTAAGCAGTGGATGG - Exonic
901735430 1:11309395-11309417 TCTCTTGGGGAAGGGGTGGGGGG - Intergenic
901778898 1:11579689-11579711 CCACCTGGGGAAGAAGTGGGAGG - Intergenic
901926655 1:12570519-12570541 TCTCCTGGGGAAGGTGAGGAGGG + Intronic
902497255 1:16881655-16881677 TCTCATGGGAAAGAAGCCTATGG - Intronic
902524323 1:17045488-17045510 TCTCAGGAGGCAGAAGTGGGAGG + Intronic
902563423 1:17293721-17293743 TCTCCTGGGGCAGAACTGCAAGG - Intergenic
903779013 1:25809938-25809960 TCTCATGGGGCTGACGTGGCAGG + Intronic
903867884 1:26411742-26411764 TCTCGTGGGGGAGTAGTGGGAGG + Intronic
903959518 1:27047842-27047864 TCTGCTGGGAATGAAGTGGATGG + Intergenic
904294339 1:29508134-29508156 TGTCATGGGGAAGACCTGAAAGG - Intergenic
904317908 1:29677762-29677784 TCTTGTGGGGAACAAGAGGATGG - Intergenic
905023224 1:34832274-34832296 TCTCATTAGGAAAAAGAGGAAGG - Intronic
905026898 1:34856664-34856686 TTTCATGGGGAAAAGGTGGCCGG - Intronic
905302609 1:36996083-36996105 CCTGACGTGGAAGAAGTGGATGG - Intronic
905934058 1:41809777-41809799 ACACATGGGGAACAAGTGAATGG + Intronic
906092142 1:43189359-43189381 TCTCATGCTCAAGAATTGGAAGG - Intronic
907089241 1:51709297-51709319 TTGCATGGGGAAGCAGTGGATGG - Intronic
907425490 1:54376635-54376657 TCTCATGAAGAAGAAAAGGAGGG - Intronic
907761532 1:57366443-57366465 TCTCTTGGGGAAGCACTGCATGG - Intronic
907925313 1:58950457-58950479 TCTCATAGGGTTGAAGTGGTGGG + Intergenic
908838804 1:68257125-68257147 TCTCATGGTGAATAATGGGAAGG - Intergenic
912988969 1:114464773-114464795 TATCAGGGGGAGGAAGAGGAAGG + Intronic
913657909 1:120978994-120979016 TCTCATGGGAAAGAAGCCTATGG + Intergenic
914009260 1:143762067-143762089 TCTCATGGGAAAGAAGCCTATGG + Intergenic
914522481 1:148430276-148430298 TCTCATGGGAAAGAAGCCTATGG + Intergenic
914647889 1:149670718-149670740 TCTCATGGGAAAGAAGCCTATGG + Intergenic
915065349 1:153220053-153220075 CCTCATGAGGAAGAGGTGGAGGG + Intergenic
915562863 1:156697561-156697583 TTTCATGGGGCAGAAGTGGGAGG + Intergenic
915640498 1:157220519-157220541 GGTCCTGGGGAAGAAGTGCAGGG - Intergenic
917500841 1:175583556-175583578 GCTCATGGGACAGAAGAGGAGGG + Intronic
920395194 1:205640196-205640218 TCTAATGGGGTAGAGGTGGGAGG - Intergenic
921525364 1:216210532-216210554 TAACATGGGGAAGAAGAAGAGGG - Intronic
922209120 1:223474112-223474134 TCCCAAGGGGGAGCAGTGGAAGG - Intergenic
1063567539 10:7184057-7184079 GCTAATGGGAAGGAAGTGGAAGG - Intronic
1066340707 10:34530098-34530120 CTTCATGAGGAAGAAGAGGAGGG + Intronic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1066523816 10:36253389-36253411 TCTCATGGGGAAGTAGTGTCAGG - Intergenic
1067217638 10:44316353-44316375 AGTGATGGGGAGGAAGTGGATGG - Intergenic
1074502490 10:114039357-114039379 TCTCCTGGGGCAGAAATGGCTGG + Intergenic
1074781571 10:116806096-116806118 TGTCATGGGCCAGAAGTGGTGGG + Intergenic
1075263458 10:120981731-120981753 ACTCATGTGGTAGAAGTGGGTGG + Intergenic
1075637237 10:124037547-124037569 TCTGATGTGGAAGTATTGGAGGG + Intronic
1075690995 10:124394093-124394115 TGCCCTGGGGATGAAGTGGAGGG - Intergenic
1075947282 10:126445997-126446019 TCTCAGGGGGAAGAATGGGAGGG + Intronic
1076516295 10:131046637-131046659 TCTCCTGGGGAAGAAGGAGAAGG + Intergenic
1083181324 11:60987721-60987743 TCTCAGGGGTAAGAAATCGATGG - Intronic
1083587007 11:63867489-63867511 TCTCTTGGGAAGGAGGTGGAAGG - Intronic
1083826763 11:65208291-65208313 TCTGATGTGGAAGAAATGGTGGG - Intronic
1085045790 11:73352690-73352712 TCTCATGAGGGAGATGTGGAAGG + Intronic
1086165153 11:83769500-83769522 TCTCCTGGGGATGGAGTGTATGG + Intronic
1086349975 11:85935316-85935338 TGTCATGACGAAGAAGCGGATGG - Intergenic
1087327083 11:96738036-96738058 TCTGATGGGGGAGATGGGGAGGG + Intergenic
1088320343 11:108549063-108549085 TCTCATTGGCATAAAGTGGATGG - Intronic
1089094370 11:115906551-115906573 CCTCCTGGGGCAGCAGTGGAGGG - Intergenic
1089287773 11:117418758-117418780 TATCATGTGGAAGAAGTAAAGGG - Intergenic
1089493834 11:118898880-118898902 GCTCTTGGGGAAGTACTGGAGGG + Exonic
1089567324 11:119378613-119378635 ACTGGTGGAGAAGAAGTGGATGG + Intronic
1090804266 11:130192943-130192965 TCTCATGGTTAATAAGTGGCAGG - Intronic
1091133646 11:133168102-133168124 TCCCAAGGAGAAGAATTGGAAGG + Intronic
1092090113 12:5797382-5797404 TGTCATGATGAAGAAGAGGAAGG + Intronic
1092125783 12:6074137-6074159 TTTCATGGGGAAAAGGAGGAGGG - Intronic
1092361584 12:7841059-7841081 TCTCATGGTGGTGAAGCGGATGG + Intronic
1092451309 12:8605110-8605132 GCTCGAGGGGAAGAAGTGGGCGG - Intronic
1092861922 12:12725705-12725727 GCCAATGGGGAAGAAGTGGGAGG - Intergenic
1093155997 12:15686125-15686147 GCTGAGGGAGAAGAAGTGGAGGG - Intronic
1094054344 12:26253765-26253787 TCTGATGGGGAAGAAGTAAAGGG - Intronic
1096331917 12:50720907-50720929 ACTCAAGGGGCAGAAGTGGAAGG - Intronic
1096375245 12:51103920-51103942 TCTAGTGGGGAAGAAAAGGATGG - Intronic
1096596171 12:52696953-52696975 CCACATGGGGAAGAAGAGGGAGG + Intronic
1098330301 12:69345810-69345832 TCCCCTGGGGAAGAAGTTAAGGG - Intergenic
1098551445 12:71766245-71766267 ACTCTTGTGGAAGAAGTGGGTGG - Intronic
1098834466 12:75405396-75405418 TAACATGGGGAAGAAGAAGAGGG + Intronic
1098881084 12:75918343-75918365 ACTCATGAGGGAGAAGGGGATGG - Intergenic
1100955335 12:99901841-99901863 TCACATGGGTAGGAAGTGGTGGG - Intronic
1101218800 12:102615074-102615096 TTTCATGGGGAAGAAATTGGGGG + Intergenic
1101254099 12:102960573-102960595 TGTCAAAGGGAAGAGGTGGATGG + Intergenic
1101919679 12:108922349-108922371 TCCCATGGGGATGATGAGGAAGG - Intronic
1102605963 12:114067340-114067362 TCTCATGGGGTAAAAGAGGAAGG + Intergenic
1103266996 12:119639004-119639026 TCTGATGTGGCTGAAGTGGAGGG - Intronic
1104536521 12:129622707-129622729 CCACATGGAAAAGAAGTGGATGG - Intronic
1104664479 12:130637810-130637832 GCTCATGGGAAAGGAGAGGAGGG + Intronic
1104917031 12:132271057-132271079 TGTCATGGAGAAGCAGCGGACGG - Intronic
1105498611 13:20952311-20952333 TTTCAAGGTGAAAAAGTGGAGGG + Intergenic
1105892543 13:24691778-24691800 TCTCAAGGGGTAGGAGAGGAGGG + Intronic
1107652833 13:42561848-42561870 TGACATGGTGAAGAAGAGGAAGG - Intergenic
1108075847 13:46679144-46679166 GCTCGTGGGGAAGAATTAGAAGG - Intronic
1109174226 13:59135617-59135639 AAGCATAGGGAAGAAGTGGATGG - Intergenic
1110762521 13:79245980-79246002 TTTCACGTGGAAGATGTGGAAGG + Intergenic
1112021446 13:95374619-95374641 TCTCTTGGGGCTGAGGTGGAGGG - Intergenic
1112214921 13:97420204-97420226 TCTCCTCTGGAAGAATTGGATGG + Intergenic
1112506546 13:99979684-99979706 GCTCCTGGAGAAGGAGTGGATGG + Intergenic
1113017563 13:105844910-105844932 TGTAGTGTGGAAGAAGTGGAGGG - Intergenic
1114128535 14:19760624-19760646 TCCAATGGGAAAGTAGTGGATGG - Intronic
1114634954 14:24182163-24182185 TCTGATGGGGGAGAACAGGAAGG + Exonic
1114919842 14:27312573-27312595 TCTCAAGGGGAAGATGAGGCAGG + Intergenic
1116576412 14:46581607-46581629 TCTCATGGGGGAGATGAGGCAGG - Intergenic
1117394717 14:55297928-55297950 TCTCAAGTCCAAGAAGTGGACGG - Intronic
1117646027 14:57853846-57853868 TCTCATGGGTTTGAAGGGGAGGG - Intronic
1118031349 14:61821146-61821168 TCTTGTGGAGAAGAAGGGGAGGG - Intergenic
1118957459 14:70496463-70496485 TCTCATGGAGAGGAAGAGAAGGG + Intergenic
1119780885 14:77276176-77276198 CCTTTTGGGGAGGAAGTGGAAGG + Exonic
1121651757 14:95564043-95564065 TCTCATGGGCAGGGAGTGGTAGG + Intergenic
1123009376 14:105340339-105340361 TCTCATTGTGAAAAAGAGGAAGG + Intronic
1123571476 15:21614888-21614910 TCCAATGGGAAAGTAGTGGATGG - Intergenic
1123608095 15:22057479-22057501 TCCAATGGGAAAGTAGTGGATGG - Intergenic
1125082091 15:35686742-35686764 TCTTATGGGGCAGGACTGGATGG + Intergenic
1126457959 15:48885108-48885130 TCTCAAGGAGAAGAAGTGTGGGG + Intronic
1128521020 15:68375052-68375074 TTTCATTGTGAAGAAGTGGAAGG + Intronic
1129003117 15:72350380-72350402 TCCCAGGTGGAAGAAGTCGATGG + Intronic
1129315515 15:74740858-74740880 TTGAATGGGGAAGAAGTGGTTGG + Intergenic
1129652742 15:77503129-77503151 CTTCATGGGGATGAACTGGAGGG - Intergenic
1129887650 15:79049688-79049710 GCTCTTGGGGAAGAAGAGGCAGG - Intronic
1130775910 15:86982596-86982618 GCTCAGGAGGAAGAAGAGGAGGG - Intronic
1131377446 15:91937314-91937336 CCCCATGGGGAACAAGTGGCGGG + Intronic
1132044918 15:98555448-98555470 TCTGATGGGGAAGGTGTGGGGGG + Intergenic
1202980330 15_KI270727v1_random:349277-349299 TCCAATGGGAAAGTAGTGGATGG - Intergenic
1132809161 16:1789482-1789504 TCTCACTGGGAAGAGGTGCAGGG - Intronic
1133257259 16:4524716-4524738 ACTCATGTGGAAGATGTGGGAGG - Intronic
1133263154 16:4565354-4565376 TGTCCTGGGGAAGAAGGGGCAGG - Intronic
1133394712 16:5437187-5437209 TATCATAGGAAAGAAGTGAAAGG + Intergenic
1133631813 16:7629162-7629184 TCTCCCTGGGAAAAAGTGGATGG + Intronic
1134174871 16:11997584-11997606 GTTCATGAGGCAGAAGTGGAAGG - Intronic
1135153213 16:20028688-20028710 TCTCATGGGGAAGGAAATGAGGG - Intergenic
1135933561 16:26760052-26760074 TCTCATTGGCATGAGGTGGAAGG - Intergenic
1136384130 16:29912046-29912068 TTTGCTGGGGAAGAAGCGGAAGG + Exonic
1136523612 16:30813957-30813979 TTTCATGGCTAAGAACTGGAAGG + Intergenic
1137681555 16:50350892-50350914 GCTCTTGGGGAAGAAGGGTAGGG + Intronic
1138063601 16:53917116-53917138 TCTCATGGGGTAGCAGAGTAAGG - Intronic
1139153093 16:64408324-64408346 TCTCATGAGGAACAAGTGAAGGG - Intergenic
1139480859 16:67229927-67229949 TCTTCTGGGGATGCAGTGGAGGG + Exonic
1139597646 16:67967761-67967783 TCTCATTAGGAAGCAGTGAAGGG - Intronic
1140198599 16:72876474-72876496 CCTCGTGGGGAGGAAGTGGTTGG - Intronic
1142079900 16:88143457-88143479 TCTTAGGGGGAAGGAGTGGGGGG - Intergenic
1142362368 16:89633459-89633481 CCTCAGGGGAAAGAAGGGGAGGG - Intronic
1143871301 17:9958975-9958997 TCTCCTGGTGAACAAGTGGAAGG - Intronic
1145058056 17:19716077-19716099 TCGCAGGGGGAAGAAGGGGCCGG - Intronic
1146059964 17:29599505-29599527 TCTGATGGGTTAGATGTGGAGGG + Intronic
1146373155 17:32277668-32277690 ACTCATGGGGCGGAAGTGAAAGG + Intronic
1147616071 17:41828688-41828710 TAACCTGGGGAAGAAGGGGAGGG - Intronic
1148940229 17:51202496-51202518 TCTTTTGGAGAACAAGTGGAAGG + Intronic
1149066438 17:52486017-52486039 TAACATGGGGAAGAAGAAGAAGG - Intergenic
1150544107 17:66135704-66135726 TCTCATTAGGAAAAAGTGAAAGG - Intronic
1151563160 17:74881624-74881646 ACTCAGGGGGCTGAAGTGGAAGG - Intronic
1153815860 18:8789550-8789572 TCTATTGGGGAAGACATGGACGG + Intronic
1154358013 18:13637144-13637166 TCACATAGGGAGGCAGTGGATGG - Intronic
1155877534 18:31104992-31105014 TGTCATGAGGAGGAAGTGAATGG - Intergenic
1155981440 18:32184450-32184472 TGTCATGGGGAAGGGGTGGAGGG - Intronic
1156451722 18:37270347-37270369 ACTCTTTGGGAAGGAGTGGAGGG - Intronic
1156646712 18:39171656-39171678 TCTCATGGTGAAGGAGTAGAAGG + Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1163268158 19:16233849-16233871 TCCCATGGGGCATGAGTGGACGG - Intronic
1164473318 19:28553987-28554009 GTTCATGGGGTAGATGTGGAAGG - Intergenic
1164481648 19:28615704-28615726 ACTCATGGGGCTGAAGTGGGAGG + Intergenic
1164691148 19:30211627-30211649 TCTCATGTGGAATTAGAGGAGGG - Intergenic
1165126441 19:33601102-33601124 TCTCATGGGGATGCAGGTGATGG + Intergenic
1165404456 19:35621214-35621236 TCCCCTTGTGAAGAAGTGGAGGG - Intronic
1166956709 19:46469937-46469959 TCCCATGAGGAAGAAGAAGAAGG - Exonic
925131009 2:1493998-1494020 TCTCATTGGGAAGCAGATGAAGG + Exonic
925162303 2:1694482-1694504 TCTCCTGGAGGAGAAGGGGAAGG + Intronic
925659427 2:6186663-6186685 TCTCATCTGGAACAAGAGGAAGG - Intergenic
926104252 2:10140502-10140524 CCTGATGGGAAAGTAGTGGATGG + Intergenic
926170806 2:10551488-10551510 TCTCATGGGGAAGCTGCTGATGG - Intergenic
926175368 2:10586663-10586685 TCTGAAGAGGAAGAAGAGGAGGG - Intronic
927498122 2:23564176-23564198 GCTCTGGGGGATGAAGTGGAGGG + Intronic
928034714 2:27811221-27811243 TCCCATGGTGATGCAGTGGAGGG - Intronic
928462409 2:31486573-31486595 TCTCATGGAGAAGAACGGAAGGG - Intergenic
930875804 2:56214236-56214258 TCTCATTTGTAAGAAGAGGATGG + Intronic
932881062 2:75502568-75502590 ACTCATGGGGAACAAAGGGAGGG + Intronic
933337635 2:80978986-80979008 CCTCATGAGGATGAAGTGGGGGG + Intergenic
934035172 2:88083142-88083164 GCTCCTGGGAAGGAAGTGGATGG - Intronic
935718092 2:105956109-105956131 TCTCACATGGCAGAAGTGGACGG - Intergenic
935841532 2:107116902-107116924 TGACCTGGGGAAGAAGTGCAAGG + Intergenic
936415210 2:112301523-112301545 TCTCATGTGAAAAAAATGGATGG - Intronic
937267855 2:120628366-120628388 TCTCTTGGGGGAGAATTGGAGGG + Intergenic
937824961 2:126358483-126358505 TCTGATGGGGATGAAGTGACTGG - Intergenic
937836136 2:126471953-126471975 TCTGATGGGGAAGATGAGGATGG - Intergenic
938294060 2:130166360-130166382 GCTTATAGGGAAGAACTGGAAGG - Intronic
939378531 2:141402922-141402944 TCAAATGGGGAAGAAATGGTTGG - Intronic
939717958 2:145609390-145609412 TCTGGAGGGGAAGAAGTGGCTGG + Intergenic
941539274 2:166761925-166761947 TGACATGGAGTAGAAGTGGATGG - Intergenic
943239692 2:185366624-185366646 GCACAGGTGGAAGAAGTGGAAGG - Intergenic
944409940 2:199430162-199430184 CCTTATGGGGAAGAACTGAAAGG + Intronic
945321108 2:208424644-208424666 TCACATTGGGAAGAAGTGATTGG + Intronic
945705563 2:213227114-213227136 TCTAATGTGGAAGAAGTTTAGGG - Intergenic
946535338 2:220621307-220621329 ACTTATGGGGAAGAAATGAAGGG - Intergenic
946773236 2:223111073-223111095 TCTTATGGGGTTGATGTGGAGGG + Intronic
948406302 2:237722596-237722618 TAAGATGGGGAGGAAGTGGATGG + Intronic
948833528 2:240612771-240612793 TCTCCAGAGGAAGAAGGGGAAGG + Intronic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1168895125 20:1319081-1319103 GCAGGTGGGGAAGAAGTGGACGG - Intronic
1169392737 20:5203465-5203487 TCTCCTGGGAAAGGAGAGGAAGG + Intergenic
1170448587 20:16457467-16457489 TCTCCTGGGGCAGAAATGAAAGG - Intronic
1170740505 20:19051758-19051780 TCTCATGAGGAAGCAGAGAAGGG - Intergenic
1171045241 20:21804617-21804639 ACTCATGGGGCTGAAGTGGGAGG - Intergenic
1172019233 20:31901145-31901167 TCTCAGGGGGAAGCAAGGGAAGG - Intronic
1172301654 20:33854721-33854743 TCCCATGGGGAGGAAGTGTAGGG + Intergenic
1172920390 20:38476487-38476509 TCTCATGGGGAAGGGGTCGGGGG - Intronic
1173174226 20:40752163-40752185 AATACTGGGGAAGAAGTGGAGGG - Intergenic
1173963299 20:47091634-47091656 ACTCAGGGGGCTGAAGTGGAAGG + Intronic
1178987262 21:37317167-37317189 ACTCAGGAGGATGAAGTGGAAGG + Intergenic
1179182256 21:39055365-39055387 TCTCTTGGGGAAGAGGAAGATGG - Intergenic
1179390005 21:40979766-40979788 TCTCACCTGGCAGAAGTGGAAGG - Intergenic
1181460596 22:23083751-23083773 TCCCCTGGGGAAGAAATGGAAGG - Intronic
1181950539 22:26550645-26550667 TCCCATGGGGAGGAATTGCAGGG - Intronic
1182303812 22:29354072-29354094 TCTCATGGGAGGGAAGTGGGCGG + Intronic
1182644926 22:31800513-31800535 TCTCATGGTCAGGAACTGGAAGG + Intronic
1183108916 22:35634234-35634256 CCTAATAGGGAAGAAGGGGAGGG - Intronic
1184331348 22:43829775-43829797 TCTCTTGGGGAGAAAGTGGCAGG - Intronic
1185038636 22:48492633-48492655 CCTCCTGGGGAAGAAGTGCCAGG + Intronic
1185109549 22:48893466-48893488 TGTCATGGGGAGGAAGAGAAGGG + Intergenic
952026406 3:29087924-29087946 TCTTTTGGAGAAGGAGTGGACGG - Intergenic
953197371 3:40746962-40746984 TCTCCTGGATGAGAAGTGGAGGG + Intergenic
954398006 3:50303231-50303253 GCTCATGGGGAAGCAGGGGTGGG - Exonic
955631713 3:60981900-60981922 TCTTATGGATTAGAAGTGGAGGG - Intronic
958044103 3:88262714-88262736 TCTCAGGAGGCTGAAGTGGAAGG + Intergenic
961083097 3:124043215-124043237 GCGCATGGGGAGGAAGTGGTGGG + Intergenic
961906161 3:130264709-130264731 TCTCATAGGGGAGAAGTTCATGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962424658 3:135259130-135259152 TTTCTTGGGGAAGGAGAGGAGGG + Exonic
963001683 3:140687513-140687535 TCAGAGGGGGAAGAAGGGGAAGG + Intronic
964838114 3:160963168-160963190 TCACAGGGGCAAGAAGTGGGCGG - Intronic
966394618 3:179489530-179489552 GCTCAGGGGGCTGAAGTGGAAGG + Intergenic
966772495 3:183516611-183516633 CGTCATGGGGAAGCAGAGGAGGG - Intronic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
968888262 4:3348802-3348824 TCTCAAGGGGAGAGAGTGGAAGG + Intronic
968947247 4:3671516-3671538 TCTGATGGGGATGGTGTGGAAGG + Intergenic
969298689 4:6284637-6284659 TCTCCTGGGGAAGTGGGGGAGGG + Intronic
969435161 4:7185185-7185207 ACTCATGGGGCTGAAGTGGGAGG - Intergenic
969940850 4:10729793-10729815 TATCATGGGGAAAAAGTTAATGG - Intergenic
971050050 4:22851350-22851372 TCTAATGGAGAAGTTGTGGAGGG - Intergenic
972287871 4:37665910-37665932 TCACATGGGGAAAAAATGGGTGG + Intronic
972447014 4:39154058-39154080 TCTCATGTGGAATTAGAGGAGGG + Intergenic
972739302 4:41875276-41875298 TCTCAGGGGGAAGCCTTGGAAGG - Intergenic
974046449 4:56902728-56902750 TCTCCTTGGGAAGAAGGGAAAGG + Intergenic
975341868 4:73251415-73251437 GCTTCTGGGTAAGAAGTGGATGG + Intronic
975380995 4:73700581-73700603 TTTCATGTGGAAGAAAAGGAAGG + Intergenic
976163480 4:82228575-82228597 TAAAATGGGGAAAAAGTGGATGG - Intergenic
978950619 4:114554703-114554725 TCTCAGGGGGAAAAAGAGGCAGG - Intergenic
979013210 4:115396880-115396902 TCTCATGGAGAAGAACAGAAGGG - Intergenic
981897631 4:149822286-149822308 ACTCAGGAGGATGAAGTGGAAGG - Intergenic
982622482 4:157724893-157724915 TGTCATGGTGAAGAATTGGTGGG + Intergenic
982688632 4:158523611-158523633 TTTCCTGGGGAAGGCGTGGAAGG - Intronic
982886150 4:160785107-160785129 TCTCATGGAGAACAGGTGAAAGG + Intergenic
982966084 4:161909942-161909964 TATCAAGAGGAAGAAGTGAATGG + Intronic
984258334 4:177413634-177413656 TCTCATGTGGCACAAGTGGTGGG + Intergenic
984618357 4:181924234-181924256 TCTCATGGGAGTGATGTGGAGGG - Intergenic
985090147 4:186354302-186354324 TCTGATAGGTAAGAACTGGATGG + Intergenic
986170467 5:5310561-5310583 TCACATGGGGAGCAAGTGGTGGG + Intronic
986517556 5:8580093-8580115 TATAATGGAGAAGAAGTAGAAGG - Intergenic
987464397 5:18254379-18254401 TAAAATGGGGAAGAAGGGGAGGG + Intergenic
988700172 5:33665857-33665879 TCTCAGGGGGAAGATGAGGCAGG + Intronic
989667111 5:43867353-43867375 TCTATTTGGGAAGAATTGGAAGG + Intergenic
990273385 5:54170235-54170257 TTACAGGGGGAAGAAGAGGAAGG - Intronic
991933658 5:71781185-71781207 TGTGGTGGGGAAGAAGGGGAAGG - Intergenic
991981530 5:72236583-72236605 TCTCAAGAGGAGGAAATGGAAGG - Intronic
992206340 5:74434018-74434040 TCAGATGGGGAAGAGGTGGGTGG + Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
992657341 5:78923267-78923289 ACTCATTGGGAACCAGTGGATGG - Intronic
992934209 5:81684949-81684971 TCTCATGGGGAATTGGAGGAGGG + Intronic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
993510649 5:88767626-88767648 TCTACTGGGGAAGGGGTGGATGG + Intronic
993741955 5:91552934-91552956 TCTCGTGGGGCAGAAGTGGGAGG - Intergenic
993972326 5:94434692-94434714 TCTCATGGTGAAAGGGTGGAAGG + Intronic
994168124 5:96629243-96629265 TCTCATGGCTAAAAGGTGGAAGG - Intronic
994216942 5:97148309-97148331 TCTAATGGGAAATGAGTGGAAGG + Intronic
995288043 5:110414556-110414578 CCTCATGAGGAAGAACTGAATGG - Intronic
996671874 5:126127509-126127531 ACTCATGGGGAAGGAGTCGGAGG - Intergenic
997260083 5:132459245-132459267 AGTCATGGGGAGGAAGCGGAGGG + Intronic
998828062 5:146125825-146125847 TCTCAATGGTAAGAAGTGGAAGG + Intronic
998885578 5:146690588-146690610 ACTTATGAGGAAGAAGTGCAAGG - Intronic
998969195 5:147572912-147572934 AGCCATGGGGAGGAAGTGGAAGG - Intergenic
999066518 5:148692720-148692742 TCTCAGGGGGATGAAGTGGAAGG + Intergenic
999499318 5:152131056-152131078 TCACATGGCAAAAAAGTGGAGGG + Intergenic
1000232089 5:159325353-159325375 TCTCATGGAGAAGGGGTGGCTGG + Intronic
1000810119 5:165851040-165851062 TTTTATGTGGAAGAGGTGGAAGG - Intergenic
1001103901 5:168836501-168836523 TTTCAAGGGCAAGATGTGGAGGG - Intronic
1001210188 5:169803785-169803807 TCTCAGTGGGAGTAAGTGGAGGG + Intronic
1001967250 5:175919804-175919826 TTTCTTAGGGCAGAAGTGGAGGG + Intronic
1002526536 5:179818754-179818776 TCAAATGGGGCTGAAGTGGAAGG - Intronic
1002674559 5:180900469-180900491 TTTCAAGGGAAGGAAGTGGAAGG + Intronic
1004087365 6:12463594-12463616 ACTCATGGAGAAGAAGTGGAAGG - Intergenic
1004782102 6:18920749-18920771 TGTCGTGGGGAAGAAGAGGAGGG - Intergenic
1011141162 6:84158300-84158322 TCTCATGGGTAAGATGGGAATGG + Intronic
1011654175 6:89534720-89534742 TCTCATGGGGATGAGGGTGAGGG + Intronic
1012290957 6:97454841-97454863 ACTCAAGGGGAAAGAGTGGAGGG - Intergenic
1012414125 6:98994066-98994088 TGTCATGGGCAAGGAGGGGAAGG - Intergenic
1012431681 6:99170754-99170776 TCCCATGGGGTATAAGAGGAGGG + Intergenic
1013668066 6:112367776-112367798 TCTCAAGGGAAAGAAGTGAAGGG - Intergenic
1013774007 6:113658844-113658866 TCTAATGGTGAGGAACTGGAGGG + Intergenic
1014842428 6:126236275-126236297 ATTCATGTTGAAGAAGTGGAAGG - Intergenic
1015000760 6:128211795-128211817 TCTCTTGAAGATGAAGTGGAGGG + Intronic
1015675577 6:135743777-135743799 TCTCATGTGGTTGAAGTTGAGGG + Intergenic
1015933327 6:138384220-138384242 TCTCAGGGGGCTGAAGTGGGAGG - Intergenic
1017186335 6:151604399-151604421 TCAGATGGTGAAGGAGTGGAGGG + Intronic
1018513793 6:164555851-164555873 TCCCCTGGGGAAGAAGAGGCTGG - Intergenic
1019230318 6:170554789-170554811 TAACATGGAGAAGAAGCGGATGG - Intronic
1019769321 7:2873616-2873638 TCTCATGGCGAAAAAGAGGTGGG - Intergenic
1020625713 7:10576866-10576888 TTTCATAGGGCAGTAGTGGAAGG - Intergenic
1021840240 7:24716539-24716561 TCTCATTGGGAACATGAGGAGGG + Intronic
1022135250 7:27441411-27441433 TCTCTTGGTGAAGAAGTGCCAGG + Intergenic
1023302832 7:38792177-38792199 TCTCATAGGTAGGAAGTGGCAGG + Intronic
1024056286 7:45661652-45661674 TCGCATGGGGAGGATGGGGAGGG - Intronic
1024350280 7:48356335-48356357 TCTCAATGGGAAGAAATGGGAGG + Intronic
1026597056 7:71742071-71742093 ACTCATGGGGAAGAAGAGAAAGG - Intergenic
1026630201 7:72031456-72031478 TCTCATTGATAAGATGTGGAAGG - Intronic
1027569320 7:79843784-79843806 ACTCAGGAGGCAGAAGTGGAAGG + Intergenic
1028564682 7:92216371-92216393 TTTCATGGGGAAAAAATGAAGGG + Intronic
1028750395 7:94376362-94376384 TCTCAGGGGGCTGAAGTGGGAGG - Intergenic
1029153838 7:98500888-98500910 TCACGTGTGGAAGAGGTGGAGGG + Intergenic
1029282032 7:99441533-99441555 TCAGATGGGGATGAAGAGGAGGG - Intronic
1030490313 7:110224454-110224476 TATCATGGGGATGAAAAGGAGGG + Intergenic
1033072235 7:138214719-138214741 TCTCATGGGGGAGATGAGGCAGG - Intergenic
1033153139 7:138934026-138934048 TCTCATCAGGAAGTAGTGTATGG + Intronic
1033195230 7:139321786-139321808 TGTCCTGGGGAAGCAGGGGAAGG - Intergenic
1034223609 7:149464853-149464875 TCTCATGTGGTAGAAAGGGAAGG - Intergenic
1034252929 7:149706664-149706686 ACTTAGGGGGAAGAAGAGGAGGG - Intergenic
1034513288 7:151553510-151553532 GCCAATGGGGAAGAAGTGGCCGG - Intergenic
1034686813 7:152979127-152979149 TCACATGGAGAAGAGATGGACGG + Intergenic
1035278074 7:157759860-157759882 TCTCTTGGGGAGGAGCTGGATGG + Intronic
1035470521 7:159106331-159106353 ACACATGGGGCAGATGTGGAAGG + Intronic
1036491010 8:9225479-9225501 TCTCCTGGGTAGGCAGTGGAAGG - Intergenic
1037471870 8:19218467-19218489 TTTCATGGGGAAGAAGGGGTTGG - Intergenic
1037885632 8:22594722-22594744 TCTCCCAGGAAAGAAGTGGAAGG - Intronic
1037897088 8:22665033-22665055 TCTCATGGGGTTGGTGTGGAAGG + Intronic
1038256123 8:25952950-25952972 TGTGATGGGAAAGAAGAGGATGG - Intronic
1038477410 8:27877903-27877925 CCTTATGGGGATGAAGAGGAAGG + Intronic
1038821982 8:30960678-30960700 TCTCATGAAGAAGAAGCAGAAGG + Intergenic
1039148429 8:34476796-34476818 TAACATGGGGAAGAAGAAGAGGG + Intergenic
1039507171 8:38060309-38060331 TCTCTTGGGGAAGGAGGGGGAGG - Exonic
1040055484 8:43053879-43053901 ACTCATGGGGGGAAAGTGGAAGG + Intronic
1041545228 8:59034941-59034963 TCTCAAGGTCAGGAAGTGGAAGG + Intronic
1041895210 8:62916772-62916794 TATCGTGGGGATGAAGTAGAAGG + Intronic
1042255464 8:66798558-66798580 TTTCAGTGGGAAGAAGTGAATGG + Exonic
1042296823 8:67228446-67228468 TCACATGGAGTAGAGGTGGAGGG - Intronic
1042594736 8:70434987-70435009 TCTCATGGGGAAGGAGAGATTGG - Intergenic
1043625828 8:82256745-82256767 TCTCAGGAGGCTGAAGTGGAAGG + Intergenic
1044248112 8:89974609-89974631 TCCCATAGGGAAGACGTAGAGGG + Intronic
1044425028 8:92040641-92040663 TATGATGGGGAAGAAATGGAGGG - Intronic
1044486188 8:92757162-92757184 CCTCCTGGGGAAGAGGTGGTAGG + Intergenic
1044738315 8:95301292-95301314 TCTGATGGGGGAGAAGAGGTGGG + Intergenic
1045769412 8:105717907-105717929 TCTCATGGTGAAGAAGTAGCTGG + Intronic
1046870821 8:119204375-119204397 TCCAGTGGGGAAGAAGGGGATGG + Intronic
1050911910 9:11082143-11082165 TATCATGAGGAAGAAGTTGATGG + Intergenic
1052866036 9:33465178-33465200 TCAGCTGGGGAAAAAGTGGAGGG + Intronic
1052949712 9:34198701-34198723 CCTCATAGGGAAGAAATGGGAGG - Intronic
1053160568 9:35810822-35810844 ACTCAGAGGGAAGAAGAGGAAGG - Intronic
1053290260 9:36875111-36875133 CCACATGGGGAAGCAGTGGGAGG - Intronic
1053932171 9:43121223-43121245 TGGCATGTGGAAGAAGTGAATGG - Intergenic
1054946607 9:70803083-70803105 TCTGAAGGGGAAGAAGAGAAGGG + Intronic
1055000746 9:71446817-71446839 TCTCATGGGGAAGAAGTGGAGGG - Intronic
1055760851 9:79605919-79605941 TCCCTGGGGGAAGCAGTGGAAGG + Intronic
1056552779 9:87664890-87664912 GCTCATGGGGCTGATGTGGAGGG - Intronic
1059250695 9:112885463-112885485 TCTCATGTGGCAGCAGTGGTAGG + Intronic
1059538772 9:115110391-115110413 TCTCAGGTTGAAGAAGGGGAAGG + Intronic
1060976858 9:127770183-127770205 GATCATGGGGATGAAGAGGAAGG - Intronic
1061316307 9:129798291-129798313 CCTCACGAGGCAGAAGTGGAAGG + Intergenic
1185484830 X:474430-474452 GCTCCTGGGGAAGAGGGGGAAGG + Intergenic
1186733968 X:12441244-12441266 TCTCATGGGGAGAAATTGAATGG + Intronic
1187223481 X:17353402-17353424 TCTCATGGGGGAGTGGTGGTGGG - Intergenic
1188004248 X:25006110-25006132 TGTCAGAGGGAAAAAGTGGAGGG + Intronic
1188199148 X:27278210-27278232 TCACCTGGGGAAGAGGAGGAGGG + Intergenic
1188385010 X:29545828-29545850 TCTCTTGGGTAAGAAGTACATGG + Intronic
1188395579 X:29678940-29678962 CCTCACTGGGGAGAAGTGGAAGG - Intronic
1188549963 X:31352418-31352440 TCCCAAGGGGAAGATGTAGATGG + Intronic
1189144601 X:38642993-38643015 TCTGCTGGGGAAGAATGGGATGG + Intronic
1189476993 X:41363830-41363852 TCCCATGGGAGAGTAGTGGAAGG - Intronic
1191721295 X:64230744-64230766 TCCCATGGGGAAGTCCTGGAAGG + Intergenic
1191922290 X:66270048-66270070 TCTCATGGAGAGGAAGGGAAGGG + Intergenic
1193857720 X:86625847-86625869 TGTCATGGGGAAGACCTGGTGGG - Intronic
1196500306 X:116373066-116373088 ACTCAGGGGGCTGAAGTGGAAGG + Intergenic
1196633862 X:117977060-117977082 TCTCATTGGGAAGAACAGTAGGG - Intronic
1196757547 X:119171181-119171203 TCTCATGGGGAAGCAGCCCAGGG - Intergenic
1197244552 X:124154801-124154823 ACTCATGAGGCTGAAGTGGAAGG + Intronic
1197402033 X:126004959-126004981 TCTCATGGAGAGGAAAGGGAGGG + Intergenic
1197588008 X:128373633-128373655 TCTCATTGGAAAGAGGTGGAGGG + Intergenic
1197663459 X:129198161-129198183 TCCAATGAGGAAGAAGTGGAGGG + Intergenic
1198274926 X:135091043-135091065 CCTAATGGGGAAGGAGTTGAGGG + Intergenic
1199269336 X:145864615-145864637 TGTCATGGGGAAGAACTGAGTGG - Intergenic
1199795144 X:151188076-151188098 TGCCATGGGGAAGAAGGGGATGG - Intergenic
1199852528 X:151735975-151735997 TCTCAGGGGGAAGAAGTACCCGG + Intergenic
1200171988 X:154083728-154083750 TCTCCTGGGACAGAAGTGAAGGG + Intronic
1200717941 Y:6571546-6571568 TCTAAAGGGCAAGAAGTGTAAGG + Intergenic
1201139045 Y:11013278-11013300 TCTAAAGGGAAAGAAATGGAAGG - Intergenic
1201337450 Y:12895881-12895903 TCTAATGGGGAGGAAGAAGAGGG - Intergenic