ID: 1055000770

View in Genome Browser
Species Human (GRCh38)
Location 9:71446911-71446933
Sequence TCCAGCCTGCGCGCGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055000766_1055000770 -10 Left 1055000766 9:71446898-71446920 CCGCGGGTCTCCCTCCAGCCTGC 0: 1
1: 0
2: 1
3: 42
4: 434
Right 1055000770 9:71446911-71446933 TCCAGCCTGCGCGCGGCTCTCGG No data
1055000762_1055000770 14 Left 1055000762 9:71446874-71446896 CCGAGCGCTCTCGCTGGCTCCTC 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1055000770 9:71446911-71446933 TCCAGCCTGCGCGCGGCTCTCGG No data
1055000765_1055000770 -5 Left 1055000765 9:71446893-71446915 CCTCGCCGCGGGTCTCCCTCCAG 0: 1
1: 0
2: 3
3: 23
4: 143
Right 1055000770 9:71446911-71446933 TCCAGCCTGCGCGCGGCTCTCGG No data
1055000760_1055000770 20 Left 1055000760 9:71446868-71446890 CCAGCGCCGAGCGCTCTCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1055000770 9:71446911-71446933 TCCAGCCTGCGCGCGGCTCTCGG No data
1055000759_1055000770 21 Left 1055000759 9:71446867-71446889 CCCAGCGCCGAGCGCTCTCGCTG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1055000770 9:71446911-71446933 TCCAGCCTGCGCGCGGCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055000770 Original CRISPR TCCAGCCTGCGCGCGGCTCT CGG Intergenic