ID: 1055001392

View in Genome Browser
Species Human (GRCh38)
Location 9:71453512-71453534
Sequence CAGAGGAATCCGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055001392_1055001397 26 Left 1055001392 9:71453512-71453534 CCAGCTTCCCTCGGATTCCTCTG No data
Right 1055001397 9:71453561-71453583 TTAAAACGAAAAGGAAACTGTGG No data
1055001392_1055001396 17 Left 1055001392 9:71453512-71453534 CCAGCTTCCCTCGGATTCCTCTG No data
Right 1055001396 9:71453552-71453574 TCTCTCTATTTAAAACGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055001392 Original CRISPR CAGAGGAATCCGAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr