ID: 1055010132

View in Genome Browser
Species Human (GRCh38)
Location 9:71556158-71556180
Sequence CCATGGAAGTGCCTGTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055010132_1055010136 6 Left 1055010132 9:71556158-71556180 CCTACACACAGGCACTTCCATGG No data
Right 1055010136 9:71556187-71556209 TGATATTATTTTATAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055010132 Original CRISPR CCATGGAAGTGCCTGTGTGT AGG (reversed) Intergenic