ID: 1055010132 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:71556158-71556180 |
| Sequence | CCATGGAAGTGCCTGTGTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055010132_1055010136 | 6 | Left | 1055010132 | 9:71556158-71556180 | CCTACACACAGGCACTTCCATGG | No data | ||
| Right | 1055010136 | 9:71556187-71556209 | TGATATTATTTTATAAAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055010132 | Original CRISPR | CCATGGAAGTGCCTGTGTGT AGG (reversed) | Intergenic | ||