ID: 1055011147

View in Genome Browser
Species Human (GRCh38)
Location 9:71566815-71566837
Sequence ATCTTAAGCTAGCAGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055011147_1055011148 -5 Left 1055011147 9:71566815-71566837 CCATAGTTCTGCTAGCTTAAGAT No data
Right 1055011148 9:71566833-71566855 AAGATTGAAGTTAGAGCAAATGG No data
1055011147_1055011149 19 Left 1055011147 9:71566815-71566837 CCATAGTTCTGCTAGCTTAAGAT No data
Right 1055011149 9:71566857-71566879 AAGCTAACAAGAGAGATAACAGG No data
1055011147_1055011150 29 Left 1055011147 9:71566815-71566837 CCATAGTTCTGCTAGCTTAAGAT No data
Right 1055011150 9:71566867-71566889 GAGAGATAACAGGAAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055011147 Original CRISPR ATCTTAAGCTAGCAGAACTA TGG (reversed) Intergenic
No off target data available for this crispr