ID: 1055012016

View in Genome Browser
Species Human (GRCh38)
Location 9:71577535-71577557
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055012016_1055012020 2 Left 1055012016 9:71577535-71577557 CCTACCTCATGAGACCTAGTGGG No data
Right 1055012020 9:71577560-71577582 GCATATCCCTCTTTCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055012016 Original CRISPR CCCACTAGGTCTCATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr