ID: 1055014637 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:71602928-71602950 |
| Sequence | AGGTGCTTCTAGGTGGGGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055014637_1055014644 | 10 | Left | 1055014637 | 9:71602928-71602950 | CCATGCCCCACCTAGAAGCACCT | No data | ||
| Right | 1055014644 | 9:71602961-71602983 | GGACAGCTTCAACAACCCTATGG | No data | ||||
| 1055014637_1055014645 | 21 | Left | 1055014637 | 9:71602928-71602950 | CCATGCCCCACCTAGAAGCACCT | No data | ||
| Right | 1055014645 | 9:71602972-71602994 | ACAACCCTATGGTTTCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055014637 | Original CRISPR | AGGTGCTTCTAGGTGGGGCA TGG (reversed) | Intergenic | ||