ID: 1055014638 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:71602933-71602955 |
Sequence | AACTGAGGTGCTTCTAGGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055014638_1055014645 | 16 | Left | 1055014638 | 9:71602933-71602955 | CCCCACCTAGAAGCACCTCAGTT | No data | ||
Right | 1055014645 | 9:71602972-71602994 | ACAACCCTATGGTTTCATCTTGG | No data | ||||
1055014638_1055014644 | 5 | Left | 1055014638 | 9:71602933-71602955 | CCCCACCTAGAAGCACCTCAGTT | No data | ||
Right | 1055014644 | 9:71602961-71602983 | GGACAGCTTCAACAACCCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055014638 | Original CRISPR | AACTGAGGTGCTTCTAGGTG GGG (reversed) | Intergenic | ||