ID: 1055014640

View in Genome Browser
Species Human (GRCh38)
Location 9:71602935-71602957
Sequence AGAACTGAGGTGCTTCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055014640_1055014645 14 Left 1055014640 9:71602935-71602957 CCACCTAGAAGCACCTCAGTTCT No data
Right 1055014645 9:71602972-71602994 ACAACCCTATGGTTTCATCTTGG No data
1055014640_1055014644 3 Left 1055014640 9:71602935-71602957 CCACCTAGAAGCACCTCAGTTCT No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055014640 Original CRISPR AGAACTGAGGTGCTTCTAGG TGG (reversed) Intergenic