ID: 1055014643

View in Genome Browser
Species Human (GRCh38)
Location 9:71602948-71602970
Sequence GAAGCTGTCCTCTAGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055014643_1055014645 1 Left 1055014643 9:71602948-71602970 CCTCAGTTCTAGAGGACAGCTTC No data
Right 1055014645 9:71602972-71602994 ACAACCCTATGGTTTCATCTTGG No data
1055014643_1055014644 -10 Left 1055014643 9:71602948-71602970 CCTCAGTTCTAGAGGACAGCTTC No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data
1055014643_1055014648 23 Left 1055014643 9:71602948-71602970 CCTCAGTTCTAGAGGACAGCTTC No data
Right 1055014648 9:71602994-71603016 GACCCAACAAATCAGCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055014643 Original CRISPR GAAGCTGTCCTCTAGAACTG AGG (reversed) Intergenic