ID: 1055014643 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:71602948-71602970 |
| Sequence | GAAGCTGTCCTCTAGAACTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1055014643_1055014645 | 1 | Left | 1055014643 | 9:71602948-71602970 | CCTCAGTTCTAGAGGACAGCTTC | No data | ||
| Right | 1055014645 | 9:71602972-71602994 | ACAACCCTATGGTTTCATCTTGG | No data | ||||
| 1055014643_1055014644 | -10 | Left | 1055014643 | 9:71602948-71602970 | CCTCAGTTCTAGAGGACAGCTTC | No data | ||
| Right | 1055014644 | 9:71602961-71602983 | GGACAGCTTCAACAACCCTATGG | No data | ||||
| 1055014643_1055014648 | 23 | Left | 1055014643 | 9:71602948-71602970 | CCTCAGTTCTAGAGGACAGCTTC | No data | ||
| Right | 1055014648 | 9:71602994-71603016 | GACCCAACAAATCAGCAGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1055014643 | Original CRISPR | GAAGCTGTCCTCTAGAACTG AGG (reversed) | Intergenic | ||