ID: 1055014644

View in Genome Browser
Species Human (GRCh38)
Location 9:71602961-71602983
Sequence GGACAGCTTCAACAACCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055014641_1055014644 0 Left 1055014641 9:71602938-71602960 CCTAGAAGCACCTCAGTTCTAGA No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data
1055014639_1055014644 4 Left 1055014639 9:71602934-71602956 CCCACCTAGAAGCACCTCAGTTC No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data
1055014643_1055014644 -10 Left 1055014643 9:71602948-71602970 CCTCAGTTCTAGAGGACAGCTTC No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data
1055014637_1055014644 10 Left 1055014637 9:71602928-71602950 CCATGCCCCACCTAGAAGCACCT No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data
1055014638_1055014644 5 Left 1055014638 9:71602933-71602955 CCCCACCTAGAAGCACCTCAGTT No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data
1055014640_1055014644 3 Left 1055014640 9:71602935-71602957 CCACCTAGAAGCACCTCAGTTCT No data
Right 1055014644 9:71602961-71602983 GGACAGCTTCAACAACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055014644 Original CRISPR GGACAGCTTCAACAACCCTA TGG Intergenic
No off target data available for this crispr