ID: 1055018225

View in Genome Browser
Species Human (GRCh38)
Location 9:71642191-71642213
Sequence ATGGGGGAGCAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055018220_1055018225 -7 Left 1055018220 9:71642175-71642197 CCAATCAAAGAAAGGGATGGGGG No data
Right 1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG No data
1055018214_1055018225 12 Left 1055018214 9:71642156-71642178 CCTGAATGATTCAAAAGAGCCAA No data
Right 1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055018225 Original CRISPR ATGGGGGAGCAGGAAGAGGA GGG Intergenic
No off target data available for this crispr