ID: 1055018448

View in Genome Browser
Species Human (GRCh38)
Location 9:71644189-71644211
Sequence GGGTGAAGCAATCCTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055018448_1055018455 0 Left 1055018448 9:71644189-71644211 CCAGTGGGAGGATTGCTTCACCC No data
Right 1055018455 9:71644212-71644234 TGGGAGTTTGAGACCAGGCTGGG No data
1055018448_1055018451 -5 Left 1055018448 9:71644189-71644211 CCAGTGGGAGGATTGCTTCACCC No data
Right 1055018451 9:71644207-71644229 CACCCTGGGAGTTTGAGACCAGG No data
1055018448_1055018454 -1 Left 1055018448 9:71644189-71644211 CCAGTGGGAGGATTGCTTCACCC No data
Right 1055018454 9:71644211-71644233 CTGGGAGTTTGAGACCAGGCTGG 0: 6
1: 406
2: 3797
3: 31541
4: 102696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055018448 Original CRISPR GGGTGAAGCAATCCTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr