ID: 1055018455

View in Genome Browser
Species Human (GRCh38)
Location 9:71644212-71644234
Sequence TGGGAGTTTGAGACCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055018440_1055018455 26 Left 1055018440 9:71644163-71644185 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1055018455 9:71644212-71644234 TGGGAGTTTGAGACCAGGCTGGG No data
1055018447_1055018455 1 Left 1055018447 9:71644188-71644210 CCCAGTGGGAGGATTGCTTCACC No data
Right 1055018455 9:71644212-71644234 TGGGAGTTTGAGACCAGGCTGGG No data
1055018442_1055018455 18 Left 1055018442 9:71644171-71644193 CCCAGCACTTTGGGAGGCCCAGT 0: 47
1: 6123
2: 229788
3: 273506
4: 169616
Right 1055018455 9:71644212-71644234 TGGGAGTTTGAGACCAGGCTGGG No data
1055018443_1055018455 17 Left 1055018443 9:71644172-71644194 CCAGCACTTTGGGAGGCCCAGTG 0: 13
1: 442
2: 9645
3: 231945
4: 268526
Right 1055018455 9:71644212-71644234 TGGGAGTTTGAGACCAGGCTGGG No data
1055018448_1055018455 0 Left 1055018448 9:71644189-71644211 CCAGTGGGAGGATTGCTTCACCC No data
Right 1055018455 9:71644212-71644234 TGGGAGTTTGAGACCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055018455 Original CRISPR TGGGAGTTTGAGACCAGGCT GGG Intergenic
No off target data available for this crispr