ID: 1055018493

View in Genome Browser
Species Human (GRCh38)
Location 9:71644757-71644779
Sequence TAGGATTCCTTGTTAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055018493_1055018495 3 Left 1055018493 9:71644757-71644779 CCTGTTTTTAACAAGGAATCCTA No data
Right 1055018495 9:71644783-71644805 CTAATTCTTTTATGACCCAAAGG No data
1055018493_1055018499 19 Left 1055018493 9:71644757-71644779 CCTGTTTTTAACAAGGAATCCTA No data
Right 1055018499 9:71644799-71644821 CCAAAGGACCCATGGAAATGTGG No data
1055018493_1055018496 11 Left 1055018493 9:71644757-71644779 CCTGTTTTTAACAAGGAATCCTA No data
Right 1055018496 9:71644791-71644813 TTTATGACCCAAAGGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055018493 Original CRISPR TAGGATTCCTTGTTAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr