ID: 1055020627

View in Genome Browser
Species Human (GRCh38)
Location 9:71665593-71665615
Sequence GACTCTGAAGAGTCGTGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055020627_1055020632 9 Left 1055020627 9:71665593-71665615 CCGCCACACGACTCTTCAGAGTC No data
Right 1055020632 9:71665625-71665647 AAGAAGGCCCTCACCAGATACGG No data
1055020627_1055020629 -7 Left 1055020627 9:71665593-71665615 CCGCCACACGACTCTTCAGAGTC No data
Right 1055020629 9:71665609-71665631 CAGAGTCCTCACCAGCAAGAAGG 0: 8
1: 86
2: 194
3: 324
4: 731
1055020627_1055020636 23 Left 1055020627 9:71665593-71665615 CCGCCACACGACTCTTCAGAGTC No data
Right 1055020636 9:71665639-71665661 CAGATACGGCCCCTCAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055020627 Original CRISPR GACTCTGAAGAGTCGTGTGG CGG (reversed) Intergenic
No off target data available for this crispr