ID: 1055023534

View in Genome Browser
Species Human (GRCh38)
Location 9:71695181-71695203
Sequence CAGCATCAGCAAAGGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1096
Summary {0: 1, 1: 6, 2: 18, 3: 179, 4: 892}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055023534_1055023536 -10 Left 1055023534 9:71695181-71695203 CCACTCTGCCTTTGCTGATGCTG 0: 1
1: 6
2: 18
3: 179
4: 892
Right 1055023536 9:71695194-71695216 GCTGATGCTGTTCCCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055023534 Original CRISPR CAGCATCAGCAAAGGCAGAG TGG (reversed) Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900299836 1:1971594-1971616 CAGCATCTGCAAAGGCTCAGAGG - Intronic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901233203 1:7652548-7652570 CAGCATCTGCGAAGTCAGGGAGG + Intronic
901480212 1:9519909-9519931 CAGCATGTGCAAAGGCTCAGAGG + Intergenic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902318420 1:15641665-15641687 GAGCATCAGGACAGGCACAGTGG + Intronic
902393567 1:16119980-16120002 CAGAATGGGCAAAGGCACAGAGG + Intergenic
902535055 1:17114871-17114893 CAGCATCCACAAAGCCAGCGTGG + Intronic
902679508 1:18033178-18033200 CAGAATGAGCAAAGGCTAAGAGG - Intergenic
902845780 1:19109772-19109794 CTGCATGTGCAAAGGCACAGGGG + Intronic
902977309 1:20098285-20098307 CAGCAAGAGCAAGGGCAGAAAGG - Intergenic
903062493 1:20679505-20679527 AAGCAACAGAGAAGGCAGAGAGG + Intronic
903101795 1:21036108-21036130 CAGGACGACCAAAGGCAGAGAGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
903661163 1:24979727-24979749 CAGCATGGGCAAAGGCTCAGAGG + Intergenic
903797794 1:25943114-25943136 CACCTTCAGCAAAGGAAAAGTGG + Intergenic
904355922 1:29939820-29939842 CAGCATAAGCAAAGGCCTGGAGG - Intergenic
904460634 1:30677661-30677683 CAGCATGTGCAAAGGCTGGGAGG + Intergenic
904490897 1:30858433-30858455 CAGCATGGGCAAAGGTAGAGAGG - Intergenic
904614785 1:31743852-31743874 AAGAATCAGCAAATGCAGGGAGG + Intronic
904851244 1:33461331-33461353 CATCATGAGAATAGGCAGAGAGG - Intergenic
905108347 1:35577145-35577167 CAGCAGCAGCAAAGGGGAAGGGG + Intronic
905284203 1:36868691-36868713 CAGCATAAGCAAAGGCCAAGAGG - Intronic
905328795 1:37177382-37177404 CAGCCTGAGCAAAGGCCCAGAGG + Intergenic
905576648 1:39050005-39050027 CCCCATCAGCAAAGGCCAAGTGG + Intergenic
905709173 1:40086296-40086318 CAGCATCTGCAAAGGCAAAAGGG + Intronic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
906049249 1:42857030-42857052 CAGAGTCAGCAAAGGGAGATAGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906520539 1:46464461-46464483 CACTATCAGCCAAGGCAGAAGGG - Intergenic
906539026 1:46570639-46570661 CAACATCCGCAACAGCAGAGGGG + Intronic
906815034 1:48870003-48870025 TAGCATAAGCAAAGGCATGGAGG - Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907016389 1:51018330-51018352 CAGCATTTGCAAAGGCAAAGAGG - Intergenic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907113533 1:51949209-51949231 CAGCATATGCAAAGGCCCAGGGG - Intronic
907234345 1:53031438-53031460 CTGCATTAGCAAAGGCAGCCTGG + Intronic
907280771 1:53345812-53345834 CAGCATATGCAAAGGCTCAGAGG - Intergenic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
907386297 1:54127725-54127747 CAGCATGTGCAAATGCAAAGAGG - Intergenic
907431646 1:54415553-54415575 CAGCATGGACAAAGGCACAGAGG + Intergenic
907440201 1:54474247-54474269 CAGCATCAGCAAAGGCACAAAGG - Intergenic
907462672 1:54614559-54614581 CAGCATGTGCAAAGGCTCAGAGG + Intronic
907516412 1:54996088-54996110 CAGCATGTGCAAAGGCACTGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907809187 1:57851597-57851619 TTGCAGGAGCAAAGGCAGAGGGG - Intronic
907831336 1:58066991-58067013 CAGCATGAGCAAAGGCTCTGAGG - Intronic
908116568 1:60946640-60946662 CTGCATGAACAAAGGAAGAGAGG + Intronic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909205266 1:72748557-72748579 CACCATCAACAAAGGCATGGGGG - Intergenic
909311819 1:74160276-74160298 AAGCATTTGCAAAGGCACAGAGG - Intronic
909664814 1:78121238-78121260 CAACAGCAGCAAAGGCATGGGGG + Intronic
909760395 1:79278818-79278840 CAACCTCAGGAAAGGCAAAGTGG - Intergenic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910331843 1:86082360-86082382 ATGCATAAGCAAAGGCTGAGAGG - Intronic
910493140 1:87795171-87795193 TGGCATCAGCAAGGGCATAGTGG + Intergenic
911002406 1:93180177-93180199 CAGCAGCACCGGAGGCAGAGCGG + Exonic
911136753 1:94448863-94448885 CAGCAGTTGCAAAAGCAGAGGGG + Intronic
911186635 1:94910973-94910995 GAGCTTTAGCAAAGACAGAGAGG - Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
912376637 1:109214505-109214527 CATCTTCAGCAAGGCCAGAGTGG + Intronic
912557357 1:110525684-110525706 CAGCTTCACCACAGACAGAGGGG - Intergenic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
913153450 1:116068794-116068816 CAACATCAGAATAGGAAGAGAGG + Exonic
913298496 1:117345466-117345488 CAGCCTCTGCAAAGGCCCAGGGG + Intergenic
913529229 1:119721693-119721715 CAGCATTAATAGAGGCAGAGGGG - Intronic
913567460 1:120087053-120087075 TAGCATAAGCAAAGGCACAGAGG + Intergenic
913630674 1:120706493-120706515 TAGCATAAGCAAAGGCACAGAGG - Intergenic
914288208 1:146247760-146247782 TAGCATAAGCAAAGGCACAGAGG + Intergenic
914549244 1:148698506-148698528 TAGCATAAGCAAAGGCACAGAGG + Intergenic
914617440 1:149373212-149373234 TAGCATAAGCAAAGGCACAGAGG - Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
915512069 1:156391932-156391954 CTTCATCACCAAAGCCAGAGTGG - Intergenic
915728989 1:158039479-158039501 CAAAAGCAGCAAAGGCTGAGCGG + Intronic
915730597 1:158051226-158051248 CAGCATAAGCACAGGCACAAAGG - Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
915906391 1:159881012-159881034 CACCATGAGCAAAGCCACAGGGG - Intronic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916592416 1:166205219-166205241 CAGCCTCTGCAAAGGCTCAGGGG - Intergenic
916676067 1:167065354-167065376 CAGCATGTGCAAAGGCTCAGAGG + Intronic
917141659 1:171841569-171841591 CAGCAGCAGCCAGGGCAGCGCGG + Exonic
917179323 1:172278034-172278056 AAACATCAGGAAAGGCAGAGAGG - Intronic
917488338 1:175475597-175475619 CAGCAGGTGCAAAGGCACAGTGG - Intronic
917712581 1:177701752-177701774 CAACATGTGCAAAGGCTGAGAGG + Intergenic
917796249 1:178534736-178534758 CAGCGTTAGCAAAGGCACAATGG - Intronic
918322263 1:183375445-183375467 CAGCCTGGGCAAAGGCATAGGGG - Intronic
919406924 1:197196813-197196835 CAGCATGTGCAAAGGCATTGAGG - Intronic
919476938 1:198040876-198040898 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919682864 1:200453564-200453586 GAGCATCTGCAGAGGAAGAGTGG - Intergenic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919836870 1:201580959-201580981 CAGCAGCTACAAAGGCATAGAGG + Intergenic
919853725 1:201691572-201691594 TAGCATCAGCAAAAGCTCAGAGG + Intronic
920397842 1:205659663-205659685 CAGGAACACCTAAGGCAGAGGGG + Exonic
920845240 1:209588139-209588161 CAGCACCAGCAAAAGGAGGGTGG + Intronic
921007031 1:211104041-211104063 AAGCAACTGCAAAGGCACAGAGG + Intronic
921040657 1:211428211-211428233 AAGCATTAGCAAAGGTAAAGAGG + Intergenic
921157891 1:212452442-212452464 CAGCATGTGCAAAGGCCCAGGGG - Intergenic
921194307 1:212739048-212739070 CTGGATCAGCAAGGGCACAGTGG - Intronic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921443623 1:215218494-215218516 CAGCATCAGGAATGACTGAGAGG - Intronic
921584400 1:216930478-216930500 CAGCAGAGGCAAGGGCAGAGAGG - Intronic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
924166078 1:241284756-241284778 CCATATCAGCAAAGGCTGAGTGG - Intronic
924743723 1:246813491-246813513 GAGAATCAGCAAAGGGAGACAGG - Intergenic
1062772108 10:110349-110371 CAGCATCAGGAAAGTAAGTGCGG - Intergenic
1062783441 10:238860-238882 CTGCATGAGTAAAGGCAGTGGGG - Intronic
1063055962 10:2504532-2504554 GATTATCAGCAAAGACAGAGAGG - Intergenic
1063299728 10:4840686-4840708 CAGTATTTGCAAAGGCACAGAGG - Intronic
1063381137 10:5587092-5587114 CAGCAGCAGCAATGACTGAGAGG + Intergenic
1063614700 10:7591627-7591649 CTGCAGCAGCAAAGACTGAGAGG - Intronic
1065520202 10:26564898-26564920 CAGCTTCAGGGAAGGCAGTGTGG - Intronic
1065532605 10:26687803-26687825 TAGCATCAACAAAGGCCCAGAGG - Intergenic
1066072424 10:31833267-31833289 CAGCAATTGGAAAGGCAGAGAGG + Intronic
1066156457 10:32683709-32683731 CTGCAGCAGCAATGGCAGAGGGG + Intronic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1068632387 10:59311243-59311265 CAGCTTCAGAATTGGCAGAGTGG + Intronic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1068981447 10:63066683-63066705 CAGCATATGCAAAGGCTCAGAGG - Intergenic
1069222103 10:65896831-65896853 CAGCATATGCAATTGCAGAGAGG - Intergenic
1069594476 10:69661878-69661900 CAGCATGAGAGAAGACAGAGGGG + Intergenic
1069806438 10:71128020-71128042 CAGCATCAGCACAGGATGAGGGG - Intergenic
1069937064 10:71924966-71924988 CAGCATGTGCAAAGACACAGAGG - Intergenic
1070055202 10:72927757-72927779 CAGCATGCGCAAAGTCAGAAGGG - Intronic
1070767095 10:79063032-79063054 GAGCATGAGCAATGGCACAGAGG + Intergenic
1071359707 10:84833831-84833853 CAGCAGCAGGAAAGAGAGAGAGG - Intergenic
1071497140 10:86176432-86176454 CAGCATGTGCAAAGGCACTGAGG + Intronic
1072668642 10:97413054-97413076 CAGCAGCTACAAAGGCACAGGGG + Intronic
1072827251 10:98619673-98619695 CATTATGAGCAAAGGCACAGAGG - Intronic
1073515960 10:104075774-104075796 CAGCATAAGCAAAGACAGCCAGG - Intronic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1073797169 10:107001124-107001146 CAGCATAAAAATAGGCAGAGAGG + Intronic
1073817324 10:107222401-107222423 CAGCATGATTAAAGGCAGAGAGG - Intergenic
1074233550 10:111561991-111562013 CAGCATATGGAAAGGCAGAGGGG - Intergenic
1074256081 10:111803873-111803895 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074389391 10:113044516-113044538 GAGCACCAGCAAAGCCACAGTGG + Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074769273 10:116722989-116723011 CAGCAAGGGCAAAAGCAGAGCGG + Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1074963199 10:118466253-118466275 CAGCATCAACAAACGCACATTGG + Intergenic
1075038345 10:119087871-119087893 GAACATCAGGAAAGGCTGAGTGG - Intergenic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075200761 10:120402016-120402038 CAGCATGTGCAAAGGCACTGGGG - Intergenic
1076006037 10:126948834-126948856 CAACCTCAGGAAAGGCATAGGGG - Intronic
1076496292 10:130899821-130899843 CAGCATTGGCAAGAGCAGAGAGG + Intergenic
1076557940 10:131341695-131341717 AAGCAACAGGAATGGCAGAGAGG + Intergenic
1076677803 10:132156494-132156516 CAGCAGCAGCGAAGGCTGGGTGG - Intronic
1076778278 10:132709998-132710020 CAGCATCAGCTGAGGCTGAGGGG + Intronic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1077774834 11:5259017-5259039 AAGCATCAGCAGAGGCAGTCAGG - Intronic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078532682 11:12149155-12149177 CAGCATCAGCAAAGGCATGTGGG + Intronic
1078567175 11:12426306-12426328 CAGCATATGCAAAGGCACTGAGG + Intronic
1079131741 11:17750696-17750718 CGGAATAAGCAAAGGCAGAAGGG - Intronic
1079170710 11:18092639-18092661 AAGTATCAGCAAAGGCAGGAAGG + Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079613708 11:22464798-22464820 CAGCATGGGCAAAGTCATAGTGG + Intergenic
1079837318 11:25350721-25350743 CGGCAGCTGCAATGGCAGAGGGG + Intergenic
1079869553 11:25780772-25780794 CTGCAGTTGCAAAGGCAGAGGGG - Intergenic
1080042343 11:27772079-27772101 CAGCATAAGCAAAGTTAGGGAGG + Intergenic
1080056371 11:27910860-27910882 CAGCAGAAGCAAAGGCACAGAGG + Intergenic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1080940710 11:36914517-36914539 CAGCATAAACAAAGGTACAGAGG - Intergenic
1081343908 11:41959156-41959178 CAGCATCAGAAATGACAAAGGGG + Intergenic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082579082 11:54844492-54844514 CAGAGTCAGCAAAGGGAGATAGG + Intergenic
1082979568 11:59107227-59107249 CAGCACCTGCAAATCCAGAGCGG + Exonic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083277578 11:61605896-61605918 CAGCTTAAGCAAAAGCACAGAGG - Intergenic
1083684214 11:64366645-64366667 CAGCAAGTGCAAAGGCACAGAGG - Intronic
1083768585 11:64854015-64854037 CAGCCACAGCAAAGGCCGGGGGG + Exonic
1083803489 11:65059890-65059912 CAGCATTTGCAAGGGCTGAGAGG + Intergenic
1083862569 11:65430272-65430294 CAGCCACAGAAAAGGGAGAGGGG - Intergenic
1084030457 11:66477828-66477850 GAGCATCTCCAGAGGCAGAGAGG + Intergenic
1084541758 11:69791317-69791339 CAGCATGGGCAAAGGCCTAGAGG + Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085217567 11:74845630-74845652 CAGCACGAGCAAAGGCGCAGAGG + Intronic
1085282124 11:75338009-75338031 CGGCTTGAGCAAAGGCACAGAGG + Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085404404 11:76253361-76253383 CAGCATAAGCAAAGACATGGAGG + Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1085716912 11:78880540-78880562 CAGCCTCAGCATAGTCAGTGTGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1085791004 11:79497828-79497850 CAGCAGCTGCAAAGGCCCAGAGG + Intergenic
1086248670 11:84787374-84787396 CAGCATTTGCAAAGGCACAGAGG - Intronic
1087082655 11:94186858-94186880 CAGCATCCGAGAAAGCAGAGAGG - Intergenic
1087127485 11:94641894-94641916 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
1087128292 11:94647196-94647218 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
1087316290 11:96606893-96606915 CATCTTCAACAAAGGCAAAGAGG - Intergenic
1087345942 11:96971173-96971195 CAGCTTAAGCAAAGGTAGAGTGG + Intergenic
1087847880 11:102993804-102993826 CAGCATAAGTAAAGGCAAGGAGG - Intergenic
1088199277 11:107313434-107313456 CAGCATGAACAAAGGTAAAGAGG + Intergenic
1088258009 11:107918972-107918994 CAGCAACTGCAAAGGCTCAGAGG + Intronic
1088376586 11:109147825-109147847 GAACATAAGCAAAGGGAGAGAGG + Intergenic
1088752692 11:112858011-112858033 AAGCATCTGCTAAGCCAGAGGGG + Intergenic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1089472408 11:118731539-118731561 CAGAGTCAGCAAAGACAGATAGG + Intergenic
1089553348 11:119299092-119299114 AAGCATTAGCCAAGGCTGAGTGG - Intronic
1089618819 11:119710677-119710699 CAGGAACAGCAAAGGCATGGTGG + Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089717810 11:120380527-120380549 CAACAGCAGCAAACGCAGACTGG - Intronic
1089770100 11:120796624-120796646 CAGCATTGGCAAAGGCATGGAGG + Intronic
1089784990 11:120901342-120901364 CAGCATGTGCCAAGGCAGGGAGG - Intronic
1090249465 11:125241294-125241316 CAGCATGTGCAAAGGCACCGAGG - Intronic
1090500102 11:127252805-127252827 CTGCACCAGCACAGTCAGAGTGG + Intergenic
1090608536 11:128449821-128449843 CAGCAGAAGCAAGGGGAGAGTGG + Intergenic
1090656656 11:128850998-128851020 CCACATCAGCAAAGGTAGAAAGG + Intronic
1090887577 11:130892881-130892903 CAGCAAGGGCAAGGGCAGAGAGG + Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091179364 11:133589487-133589509 CAGCATCATCCAGGGAAGAGAGG + Intergenic
1091214482 11:133892297-133892319 CAGCCACAGCAGAGGCGGAGAGG - Intergenic
1091817184 12:3447440-3447462 CAGCATAAGCAAAGGCCCAGAGG - Intronic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092004462 12:5057437-5057459 CAGCTTGAGCGAAGGCACAGAGG + Intergenic
1092006350 12:5073776-5073798 CAGGCTTGGCAAAGGCAGAGAGG + Intergenic
1092513997 12:9188550-9188572 GGGCATCAGCATAGGAAGAGAGG + Intronic
1092529404 12:9332072-9332094 CAGCCTCAGGAGAGGCAGTGAGG - Intergenic
1092548379 12:9471232-9471254 CATCATTATCAAAGGCAGGGTGG + Intergenic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1092905493 12:13097182-13097204 GAGCATCAGCAAAGGCTTGGAGG - Intronic
1093073477 12:14732152-14732174 CACCAGCAGCAAAAGCTGAGTGG - Intergenic
1094070065 12:26403163-26403185 CAGGATGAGCAAAGGCAAACAGG + Intronic
1094166252 12:27446870-27446892 CAGCATCAGCAAAAGCATCAGGG - Intergenic
1094168541 12:27466841-27466863 CCTCAGCACCAAAGGCAGAGAGG - Exonic
1094504622 12:31051217-31051239 AGGCATCATCAAAGGCAGGGTGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1094752069 12:33421884-33421906 CAGCATGAACAAAAGCACAGAGG + Intronic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095587327 12:43863691-43863713 CAGCAAAAGCAATGGCTGAGAGG + Intronic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096320444 12:50607651-50607673 TATAATCAGCAAAAGCAGAGTGG + Intronic
1096424272 12:51487864-51487886 CAGCATAAATAAAGGCAAAGTGG - Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096515536 12:52153227-52153249 CAGGGTCAGCAGAGGCTGAGGGG - Intergenic
1097226453 12:57479298-57479320 CAGTATAAGTAAAGGCATAGAGG + Exonic
1097422928 12:59403190-59403212 CAACGTCAGCAAAAGCAGAAAGG - Intergenic
1098352616 12:69580240-69580262 TAGCATGTGCAAAGGCACAGAGG + Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101223343 12:102663075-102663097 CAGCAGTTGCAAAGGCAGAAAGG - Intergenic
1101454398 12:104815000-104815022 GAGAATGTGCAAAGGCAGAGAGG - Intronic
1101529398 12:105560322-105560344 CAGCATGAGCAAAAGCTCAGAGG - Intergenic
1101695473 12:107121775-107121797 TAGCATGTGCAAAGGCACAGGGG + Intergenic
1101947348 12:109147659-109147681 CAGCACCAGCCTAGGCAGTGGGG - Intronic
1102018310 12:109663402-109663424 CAGCATAGGCAAAGGCCCAGAGG - Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102089701 12:110175291-110175313 CAGCTACTGCAAAGGCTGAGTGG + Intronic
1102242103 12:111331027-111331049 CAGCCTGAGCAAAGACATAGGGG + Intronic
1102281899 12:111625025-111625047 CAGCAGAAGCAAAGGCACAGAGG - Intergenic
1102624471 12:114223982-114224004 CAACGTAAGCAAAAGCAGAGAGG + Intergenic
1102772748 12:115492799-115492821 AAGCAGAAGGAAAGGCAGAGGGG + Intergenic
1102814989 12:115858487-115858509 CAGCATAAGCAAAGGCCTGGTGG + Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1102826038 12:115948619-115948641 CAGGATGTGCAAAGGCCGAGAGG + Intergenic
1103003916 12:117406814-117406836 CAGCATGTGCAAAGGTACAGAGG - Intronic
1103018538 12:117514936-117514958 CAGCATATGCAAAGGCTTAGAGG - Intronic
1103201127 12:119088796-119088818 CAGCTTGAACAAAGCCAGAGAGG + Intronic
1103219980 12:119235926-119235948 CAGCATATGCAAAGGCACAGAGG - Intergenic
1103256204 12:119543578-119543600 CAGCATGTGCAAAGGCCGAGAGG + Intergenic
1103445200 12:120989922-120989944 CAGCATCAGTAAAGGCTCAGAGG + Intronic
1103540703 12:121664436-121664458 CTGCATGAGTAAAGGCAAAGAGG + Intronic
1103696621 12:122820901-122820923 CAGCATGAGTAAAAGCACAGAGG + Intronic
1103831986 12:123787659-123787681 CCTCATCGGAAAAGGCAGAGCGG - Intronic
1104134350 12:125923295-125923317 AAGCATCAGGGAAGCCAGAGTGG + Intergenic
1104310454 12:127650126-127650148 CAGAATCAGCACATTCAGAGAGG - Intergenic
1104673509 12:130696876-130696898 CAGCTTCTGCAAAAGCACAGAGG + Intronic
1104692154 12:130834436-130834458 CAGCACCTGCAAGGGCAGGGAGG + Intronic
1105401828 13:20103034-20103056 CTGCATCAGGAAAGGCAGACGGG + Intergenic
1106355291 13:28976284-28976306 CAGCATGAGTTGAGGCAGAGAGG + Intronic
1106395569 13:29377903-29377925 CAGCATCGGCAATGGAAGAGAGG + Intronic
1106443402 13:29801095-29801117 CTGCATCTGCAATGGCAGAGGGG - Intronic
1106580892 13:31017310-31017332 CAGCATGTGCAAAAGCACAGAGG + Intergenic
1106591922 13:31105415-31105437 CAGAACCAGCAAAGCCTGAGGGG - Intergenic
1106614083 13:31310538-31310560 CAGCACCAGCAAAGGGTGGGAGG - Intronic
1106702638 13:32246461-32246483 TAGCATGAGTAAAGGCACAGAGG + Intronic
1106881606 13:34138070-34138092 CCTCATCAGCAGAGGCAGACAGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1108013645 13:46050002-46050024 GAGCATTATCAAAGACAGAGTGG + Intronic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1108726636 13:53190495-53190517 TAGCAAGAGCAAAGGCACAGTGG + Intergenic
1108960298 13:56218482-56218504 AAGCATCAGCAAATTCACAGTGG - Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110259678 13:73471445-73471467 TGGCATGAACAAAGGCAGAGTGG + Intergenic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1110646290 13:77888686-77888708 CAACATAAGCAAAGTCAGAAAGG - Intergenic
1110713818 13:78679128-78679150 CTGCATAAGCAAAGACATAGAGG - Intergenic
1110888267 13:80666290-80666312 CCTCATCAACAAAGTCAGAGAGG - Intergenic
1111424345 13:88059402-88059424 ACACATCAGCAAAGGCTGAGTGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112140432 13:96635398-96635420 CAGCATAAGCTAAGGCAGAAGGG - Intronic
1112641230 13:101277873-101277895 CCACATGAGCAGAGGCAGAGAGG - Intronic
1112824745 13:103379266-103379288 TAGCATAAACAAAGGCACAGGGG + Intergenic
1113069072 13:106401468-106401490 GAGGAAGAGCAAAGGCAGAGTGG + Intergenic
1113647380 13:112008442-112008464 CAGCATCAGCAAACAGACAGGGG + Intergenic
1114515144 14:23294463-23294485 CAGCATTTGCATAGCCAGAGGGG + Intronic
1114531187 14:23397342-23397364 CAGAATCATCAAAGGGACAGGGG + Intronic
1114672130 14:24416965-24416987 CAGGTGCAGCAAAGGCAGGGAGG - Exonic
1114678092 14:24459002-24459024 CAGCTTGGGCCAAGGCAGAGTGG + Intergenic
1114771284 14:25430635-25430657 GAGAATCAGCAAAGGGAGATAGG + Intergenic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1114948591 14:27717424-27717446 CAGCATTTGCAAATGCACAGAGG - Intergenic
1115706717 14:36006936-36006958 AAGCACCAGCAAAGACACAGAGG + Intergenic
1115742468 14:36403100-36403122 CGGCATGTGCAAAGGCACAGAGG - Intergenic
1116238252 14:42308984-42309006 CAGCAGTTGCAAAAGCAGAGGGG - Intergenic
1116576283 14:46580434-46580456 CAGAATCAGGAAATCCAGAGAGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117082995 14:52170695-52170717 CAGCAGTTGCAAAAGCAGAGGGG + Intergenic
1117113439 14:52483982-52484004 TGGCATGAGCAAAGGCACAGTGG + Intronic
1117166164 14:53036112-53036134 CAGCAAATGCAAAGGTAGAGAGG + Intergenic
1117434318 14:55701710-55701732 CAGTATCAGGAAAGTCAGACAGG - Intergenic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118009381 14:61593938-61593960 CAGCATATGCAAAGGCAAAGAGG + Intronic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1118886584 14:69872259-69872281 CAGCATATGCAAAGGCATTGAGG - Intronic
1118888785 14:69889451-69889473 CAGCCTCAGCATAGGCTCAGAGG + Intronic
1119402370 14:74371961-74371983 CAGCTGCAGCACAGGGAGAGTGG - Intergenic
1119931221 14:78549304-78549326 TAGCAACAGCAAAGGCATAAAGG - Intronic
1119954747 14:78784866-78784888 CAGCCTGAGCAAAGTCACAGGGG + Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120250875 14:82060998-82061020 GAGAATCAGCAAAGGGAGACAGG + Intergenic
1120691751 14:87600565-87600587 CAGAATCAAAAAAGGCAGATGGG + Intergenic
1120902194 14:89585156-89585178 CAGCATCAGCAAAATTATAGAGG - Intronic
1120949961 14:90031743-90031765 CAGCATCCGCAAAGGCCCAGAGG - Intronic
1121240437 14:92426064-92426086 CAGCATCAGGGCAGGGAGAGAGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121442022 14:93955509-93955531 CAGCATCAGGAAAAGCCCAGTGG + Intronic
1121665586 14:95669725-95669747 CAGCATACGCAAAGGCAGAAAGG - Intergenic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122194225 14:100073157-100073179 GAGTGTCAGCAAAGGCAGAGTGG - Intronic
1122507372 14:102240204-102240226 CAGAGTCAGCAAAGGGAGATAGG - Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1123724109 15:23085182-23085204 CAGCATATGCCAAGGCACAGAGG + Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1125394078 15:39227819-39227841 CAGCATAATCAAAGACACAGAGG + Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126233410 15:46354176-46354198 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1126653931 15:50955872-50955894 CCACACCAGCAAAGGCAGAGTGG - Intronic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1126795352 15:52256304-52256326 CAGCAAGTGCAAAGACAGAGAGG + Intronic
1127104464 15:55598150-55598172 CAGCATTAGCAAAGCCACCGTGG - Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127671452 15:61198929-61198951 GAGCCTCAGCAAAGGCAGGAAGG - Intronic
1127797777 15:62453428-62453450 CAGCACCTGCAAAGGAAGAAAGG - Intronic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1127961732 15:63895338-63895360 CAGCTTGAGCAAAGACACAGAGG - Intergenic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128195563 15:65751608-65751630 AGGAATCAGCAAAGGCAGAAAGG + Intronic
1128243302 15:66116095-66116117 CCCCATCAGCAAAGGCATGGAGG - Intronic
1128369147 15:67026868-67026890 TGGCATGAGCAAAGGCATAGAGG - Intergenic
1128477860 15:68012772-68012794 CAGCATAAGCAAAGTCACGGAGG + Intergenic
1128484569 15:68072004-68072026 CAGCATGAGCAAAGGTAATGAGG + Intronic
1128699431 15:69793619-69793641 CAGAGTGAGCAAAGGCACAGAGG - Intergenic
1128798863 15:70484365-70484387 CAACATGAGCAAGGGCAAAGAGG - Intergenic
1128945109 15:71814499-71814521 CATCATTTGCAAAGGGAGAGAGG + Intronic
1129172334 15:73815878-73815900 CAGCATGTGCAAAGGCCCAGAGG - Intergenic
1129252294 15:74315722-74315744 CTGCGTGAGCAAAGGCACAGAGG + Intronic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129466783 15:75728563-75728585 CAGCAGCAGCAAAGCCAGAGCGG - Intergenic
1129487466 15:75888854-75888876 CTGCATCCTCAAAGGAAGAGTGG + Intronic
1129605246 15:77021777-77021799 CAGCAGGAGCAAAGGCCCAGAGG - Intronic
1129720462 15:77875215-77875237 CAGCAGCAGCAAAGCAAGAGCGG + Intergenic
1130739867 15:86587560-86587582 CAGTATAAGCAAAGGCATAAAGG + Intronic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131118730 15:89809905-89809927 CAGAATGAGCAAAGTCACAGAGG - Intronic
1131223019 15:90600928-90600950 TGGCCTTAGCAAAGGCAGAGGGG + Intronic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1133201632 16:4207539-4207561 CAGCAGAGCCAAAGGCAGAGGGG - Intronic
1134067736 16:11240057-11240079 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
1135404285 16:22186980-22187002 CAGCCTCAGCAAAAGCCCAGAGG - Intronic
1135724501 16:24844428-24844450 CAGCACCAGGAAAGGCAGTGGGG - Intergenic
1136050388 16:27646059-27646081 TAGCATAAGCAGAGGCACAGAGG + Intronic
1136069274 16:27778365-27778387 CAGCCTGGGCAAAGGCTGAGAGG + Intronic
1136095466 16:27952484-27952506 CAGCACATGCAAAGGCACAGAGG + Intronic
1136372684 16:29846088-29846110 CAGCATAAGCCAAGGCCGTGGGG + Intronic
1136453058 16:30365204-30365226 CAGCTTCACCTAAGGCAAAGTGG + Exonic
1136515858 16:30768086-30768108 CCGGAGCTGCAAAGGCAGAGAGG - Exonic
1136607311 16:31345026-31345048 CAGCATAGGCAAAGGTTGAGAGG - Intergenic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1138143659 16:54589332-54589354 CAGCATCAGCCTAAGCATAGTGG - Intergenic
1138482011 16:57309705-57309727 CATCATGAGCAAAGGCCTAGGGG + Intergenic
1138596166 16:58030162-58030184 CTGAGTCAGCAAAGACAGAGAGG + Intronic
1138713669 16:58997607-58997629 CAGCTTCAGTCAGGGCAGAGGGG + Intergenic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139469677 16:67171422-67171444 CAGCATCAGCAAAGGCTCCGAGG + Exonic
1139526132 16:67518054-67518076 CAGCATTAGCAAAGGCCCAAGGG + Intergenic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1140094704 16:71864837-71864859 CAGCATCAGGGCAGGCAGAAGGG + Intronic
1140253158 16:73312573-73312595 ATGCATGAGCAAATGCAGAGGGG + Intergenic
1140533153 16:75684192-75684214 AAGAATCAGCTAAAGCAGAGGGG + Intronic
1140619842 16:76716708-76716730 CAGCATCAGCTATAGCAGTGTGG - Intergenic
1140727864 16:77830238-77830260 CAGCATATGAAAAGGCACAGAGG - Intronic
1141091900 16:81136104-81136126 CAGCACCTGCAAAGGCCGCGAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142223591 16:88866727-88866749 GAGCATTTGCAAAGGCTGAGTGG + Intergenic
1142299730 16:89249342-89249364 CACCCTCAGAGAAGGCAGAGTGG - Intergenic
1142693703 17:1621820-1621842 CAGCATCGGCACAGACCGAGTGG - Intronic
1142857686 17:2741154-2741176 CAGCATCTGTGAAGGCACAGAGG + Intergenic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143339247 17:6196219-6196241 CAGCATTTGCCAAGGCAAAGAGG - Intergenic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1144028697 17:11301117-11301139 CGGGCTCAGCACAGGCAGAGAGG - Intronic
1144292204 17:13837576-13837598 CTCCATCATCAAAGGCCGAGTGG + Intergenic
1144481762 17:15635750-15635772 CAACATATGCAAAGGCAGAGAGG - Intronic
1144507355 17:15843854-15843876 TAGAATGAGCAAAGGCACAGAGG + Intergenic
1144665117 17:17097090-17097112 CAGGATCAGCCAAAGCAGAGGGG + Intronic
1144916538 17:18728022-18728044 CAACATATGCAAAGGCAGAGAGG + Intronic
1145063970 17:19749564-19749586 GAGCAGAAGCAAAGGCACAGAGG + Intergenic
1145119251 17:20241874-20241896 TAGAATGAGCAAAGGCACAGAGG + Intronic
1145171480 17:20661459-20661481 TAGAATGAGCAAAGGCACAGAGG + Intergenic
1145274050 17:21419631-21419653 CAGCACCAGCAGAGGCTCAGGGG - Exonic
1145311913 17:21705530-21705552 CAGCACCAGCAGAGGCTCAGGGG - Intergenic
1145887229 17:28390813-28390835 CAGCATGAGCAAAGGAATAAAGG + Intronic
1145911438 17:28545731-28545753 CAGCATAAACAAAGGCTCAGAGG - Intronic
1145963665 17:28902278-28902300 CAGCATAAGCAAAGGCTCTGAGG - Intronic
1145991125 17:29080102-29080124 CATCAGCAGCAGAGGCGGAGCGG + Intronic
1146501918 17:33372075-33372097 CAGCTTCAGGAGAGGCAGAGAGG - Intronic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1147462351 17:40581428-40581450 CAACATCAGTAAAGGCAGCCTGG - Intergenic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1148450983 17:47777772-47777794 CAGCCCCAGCAATGGCAGATTGG + Intergenic
1148680018 17:49468286-49468308 CAGCAGGAGCCAAGGCTGAGAGG + Intronic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1149035058 17:52124699-52124721 CAGCATAGGCAAAGGCTTAGAGG - Intronic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150599582 17:66639144-66639166 GAGCAGCTGCAAAGGCAGAGTGG - Intronic
1151209614 17:72534682-72534704 CAGCATATGCAGAGGCACAGAGG - Intergenic
1151518197 17:74610874-74610896 CAGCATAAGTGAAAGCAGAGAGG - Exonic
1151583249 17:74992131-74992153 GAGACTCAGCAAAGGGAGAGGGG - Intronic
1152491075 17:80635140-80635162 GAGGAGCAGCAATGGCAGAGAGG - Intronic
1152938712 17:83154645-83154667 CAGCCTCAGGACAGGCCGAGTGG - Intergenic
1153484474 18:5582866-5582888 GAGCGTCAGCAGAGGCAGTGAGG + Intronic
1154983183 18:21521486-21521508 CAGCATGAGAACAGGGAGAGGGG + Intronic
1155224086 18:23713272-23713294 CAGCACGAGCAAGGGCACAGGGG - Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1156808059 18:41211100-41211122 AAGCACCAGAAAAGGCAGAAGGG - Intergenic
1157381391 18:47221538-47221560 CAGCAGGGGCAAAGGCACAGAGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157650761 18:49327969-49327991 CAGAAACAGCAAAGGCTCAGGGG + Intronic
1157676033 18:49569284-49569306 CATCACCAGCAAAGCCAGTGGGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1157995306 18:52547736-52547758 CAGCATGAGCAAAGGAACAAAGG + Intronic
1158388171 18:57018510-57018532 CAGCATCAGCCAGGGCTGAGTGG - Intronic
1158878066 18:61751978-61752000 CAGCAGAGGGAAAGGCAGAGGGG - Intergenic
1159137594 18:64354894-64354916 CAGCATCTGCTAAGGCATAAAGG + Intergenic
1159678307 18:71313883-71313905 CCCCATCAGCAAAGGCTAAGTGG + Intergenic
1159798635 18:72869942-72869964 AAGCTTGAGCAAAGGGAGAGAGG + Intergenic
1159853191 18:73551458-73551480 CAGCATCAGAAATGCCACAGGGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1161483279 19:4521481-4521503 CAGCCTCAGCAAAGGCCCGGAGG + Intergenic
1161501337 19:4617731-4617753 CAGCATGGGCAAAGGCCGGGTGG - Intergenic
1161502605 19:4624964-4624986 CAGCTTCAGCAAAGGCTTGGGGG - Intergenic
1161620592 19:5294959-5294981 CAGCATCACCAAAGGCACACAGG + Intronic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162932138 19:13962586-13962608 CAGCCTCAGCCAGGGCAGGGAGG - Exonic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1164569911 19:29366324-29366346 CAGCATGAGCAAGGGGACAGAGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165154758 19:33780315-33780337 CAGCATAAGCAAGGTCACAGCGG + Intergenic
1165278828 19:34779648-34779670 CAGCATCAGCAAATCCACATTGG - Intergenic
1165940958 19:39414514-39414536 CAGCATGTGCAAAGGCCCAGCGG + Intronic
1166138411 19:40791529-40791551 CAGCATGAGCAAGGGCCCAGAGG - Intronic
1166530054 19:43536997-43537019 CAGCAGCAGACCAGGCAGAGTGG + Intergenic
1166740389 19:45111193-45111215 CAGCATGTGCAAAGGCTCAGAGG - Intronic
1167615822 19:50532518-50532540 GAGCCTGTGCAAAGGCAGAGAGG - Intronic
1167681099 19:50921939-50921961 CAGCATCAGCAGGTGCTGAGTGG + Intergenic
1167771889 19:51525863-51525885 CTGCAGCAGCAATGGCAGAGGGG - Intronic
1168016501 19:53577842-53577864 CAACATCAGAAAACGCACAGTGG + Exonic
1168163634 19:54530846-54530868 CAGCATAAGTAATAGCAGAGGGG - Intergenic
1168626990 19:57926832-57926854 CAGCATCAGCGAAGCCACACTGG - Exonic
926201481 2:10802765-10802787 CTGCAGCAGGAAGGGCAGAGGGG - Intronic
926268926 2:11350363-11350385 CAGCACCAGCAAAGGCACAGAGG - Intergenic
926295207 2:11564080-11564102 CAGCATGTGCAAAGGCTTAGTGG + Intronic
926590524 2:14735415-14735437 AAGCATCAGCAGAGCCAGAATGG - Intergenic
927079491 2:19613490-19613512 CCTCATCAGCAAAGACTGAGTGG + Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927151017 2:20196283-20196305 CAGCATAGGCAAAGGCCCAGAGG - Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927460553 2:23294804-23294826 CAGCATCAGCAAAGGCCTGGAGG - Intergenic
928062867 2:28132574-28132596 CAGCTTTAGCAAAAGCACAGAGG - Intronic
928312755 2:30224068-30224090 CAACATCAGCAAAGGTGTAGGGG - Intergenic
929043981 2:37773050-37773072 CAGAAGCAGTACAGGCAGAGGGG - Intergenic
929579778 2:43074520-43074542 TAGCCTAAGCAAAGGCAGAGAGG + Intergenic
929828528 2:45329212-45329234 CAGTATTAGCAAAGGCATGGAGG - Intergenic
929868549 2:45738397-45738419 AGGCATGAGCAAAGGCAGAGAGG - Intronic
929870010 2:45751104-45751126 GAGTATAAGCAAAGGCACAGAGG - Intronic
929875286 2:45791734-45791756 TAGCACCAGCAAGGGCAGAGAGG - Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929876498 2:45801053-45801075 CAGCATAAGTGAAAGCAGAGAGG + Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930233015 2:48861600-48861622 GAGCATGAGCAAAGGCACAACGG - Intergenic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931273053 2:60719595-60719617 CAGCCTGAACAAAGGCACAGAGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932276075 2:70453322-70453344 CAGCAGCTGCAAAGACACAGAGG + Exonic
932402094 2:71487794-71487816 CAGCATCAGACCAGGCACAGTGG - Intronic
932809789 2:74815199-74815221 CAGAATCTGCAAATACAGAGGGG - Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933351412 2:81156982-81157004 CAGCATCAGGAAAGGAGGACAGG - Intergenic
933910903 2:86940707-86940729 CAGCTACTCCAAAGGCAGAGGGG - Intronic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934021826 2:87962703-87962725 CAGCTACTCCAAAGGCAGAGGGG + Intergenic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
935061417 2:99611518-99611540 CTCCATCAGCAAAGCCTGAGTGG - Intronic
935351927 2:102158546-102158568 CAGCATGTGCAAAGGCCCAGAGG + Intronic
935532158 2:104247672-104247694 CAGGATGAGCAAAGGGAAAGAGG + Intergenic
935557722 2:104528561-104528583 CAGCATCAGGATTGGCAGAGAGG - Intergenic
935697300 2:105781297-105781319 CAGGACCTGCAAAGGCACAGAGG - Intronic
935990787 2:108717318-108717340 CAGCTACTCCAAAGGCAGAGGGG - Intergenic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936351633 2:111717090-111717112 CAGCAGGAGTTAAGGCAGAGTGG + Intergenic
936380923 2:111985265-111985287 CAGCAGCAGGAAAGGCAGCTGGG + Intronic
936798577 2:116237741-116237763 CAGAATACGCACAGGCAGAGCGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937350645 2:121158663-121158685 CATCTTCAGCAAAGGCCAAGTGG - Intergenic
937505658 2:122533753-122533775 CAGCATCACTGGAGGCAGAGTGG + Intergenic
937790446 2:125955144-125955166 CAGCATTTGCAAAAGCAAAGAGG - Intergenic
937973441 2:127566819-127566841 CATCATCAGGTGAGGCAGAGGGG + Exonic
938672187 2:133597158-133597180 CAGCATCCGGCAAAGCAGAGTGG + Intergenic
938686562 2:133743436-133743458 TAGCATCAGAAAAGGCACAGTGG - Intergenic
938923008 2:136012425-136012447 AAGCACGAGCAAAGGCAGAGAGG - Intergenic
939026496 2:137020226-137020248 TAGCTTGAGCAAAAGCAGAGGGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939460247 2:142489773-142489795 CAGAGTCAGCAAAGGGAGATGGG + Intergenic
940003591 2:148991251-148991273 CAGCACCAGCAAGGGCATGGAGG - Intronic
940970924 2:159895876-159895898 CAGCATCAGCAAAGAATGTGTGG - Intronic
941549807 2:166901033-166901055 TCCCATCAGCAAAGGCTGAGTGG - Intronic
941713452 2:168739338-168739360 CACCATGAGCAAAAGCGGAGAGG + Intronic
942408850 2:175685351-175685373 CAGCATGAGCAAAGGAAGAAAGG - Intergenic
943376517 2:187084300-187084322 CAGCTTAAGCAAAGGCAAAGAGG + Intergenic
943723867 2:191232974-191232996 CACCATCAAAACAGGCAGAGAGG - Intergenic
943836532 2:192521259-192521281 TAGCATAAACAAAGGCACAGAGG - Intergenic
944471221 2:200055449-200055471 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944897396 2:204178774-204178796 CAGCATGTGCAAAGGCCCAGAGG + Intergenic
944968901 2:204968591-204968613 CAGTATCTGCAAAGGCACAGAGG - Intronic
945374870 2:209068005-209068027 CTCCACCAGCAAAGGCTGAGGGG - Intergenic
946166781 2:217869336-217869358 CAGCCTCTGAAAAGGCAGGGAGG + Intronic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946243678 2:218372861-218372883 CAGCATATGCAAAGGCCTAGAGG + Intergenic
946927893 2:224643862-224643884 CAGGATCAGCACAGGCAGCCAGG - Intergenic
947986171 2:234449526-234449548 CAGCATTAAAAAAGTCAGAGGGG - Intergenic
948101713 2:235379880-235379902 TAGCATCAGCAAAAGTGGAGGGG + Intergenic
948726699 2:239938640-239938662 CAGCTCATGCAAAGGCAGAGAGG - Intronic
1168876378 20:1174851-1174873 CAGCATGAGCAGAGGCTCAGAGG - Intronic
1169052653 20:2593979-2594001 GGCCATAAGCAAAGGCAGAGAGG - Intronic
1169253996 20:4083415-4083437 CCGCACCATCAAAGGCTGAGTGG - Intergenic
1169843610 20:9965969-9965991 CAAAAACAGGAAAGGCAGAGAGG + Intergenic
1169846843 20:10003149-10003171 CAGCAAGGGCAAAGGCAGAGAGG - Intronic
1169857195 20:10115782-10115804 CGGAAATAGCAAAGGCAGAGAGG - Intergenic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170584239 20:17722390-17722412 TTCCCTCAGCAAAGGCAGAGCGG + Intronic
1171229502 20:23472122-23472144 CAGCAGCTGCAAAAGCAGAAGGG + Intergenic
1171432313 20:25090862-25090884 CAGCATCCGGCAAGGCAGATGGG - Intergenic
1171851730 20:30313558-30313580 CAGCATGAGCAAAGGCTGCAAGG - Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172197013 20:33098905-33098927 CAGCATCTGCAAAGGCCCTGAGG - Intronic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172587908 20:36097730-36097752 TAGCATGTGCAAAGGCAGAACGG + Intronic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172805555 20:37609278-37609300 CAGCCTAAGCAAAGTCAGAGAGG - Intergenic
1172809977 20:37640527-37640549 CAGCATGTGCAAAGGCTAAGAGG + Intergenic
1172821493 20:37738831-37738853 GAGCATGAACAAAGGCACAGAGG + Intronic
1172956987 20:38767925-38767947 TAGCATGAGCAAGGGCACAGGGG + Intronic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173168086 20:40700287-40700309 CAGCACAAACAAAAGCAGAGAGG - Intergenic
1173215854 20:41082531-41082553 GAGCATCAGCAAAGTCCCAGGGG - Intronic
1173365228 20:42379174-42379196 CAGCATATGCCAAGGCACAGAGG - Intronic
1173591909 20:44231433-44231455 CAGCCTCCCCAAAGGCAGGGAGG - Intergenic
1173744574 20:45426538-45426560 CCACATCAGCAAGGGTAGAGTGG + Intergenic
1173878515 20:46392684-46392706 CAGCATATGCCAAGGCACAGAGG - Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174101203 20:48127410-48127432 CAGCATGTGCAAAGGCCTAGCGG - Intergenic
1174483703 20:50848476-50848498 CTGCATGAGCCAGGGCAGAGTGG + Intronic
1174582394 20:51581185-51581207 CAGCAGGACCAAAGGCACAGAGG - Intergenic
1174929203 20:54794503-54794525 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1175411806 20:58775317-58775339 CAGCATCTGCATAGGAATAGGGG - Intergenic
1175501055 20:59451151-59451173 CAGCAGCAGCAAGGGGAAAGGGG - Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1176241151 20:64076543-64076565 CAGCACCAGCACAGGCAGCAGGG + Exonic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179035044 21:37752465-37752487 CAACAGCAGCAAAAGCCGAGAGG + Intronic
1179286556 21:39982804-39982826 CTGCATTAGCAATGGCACAGAGG - Intergenic
1179775889 21:43661840-43661862 CAGGAGAAGCAAAGGCAGAGAGG - Intronic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180903091 22:19388819-19388841 TAGCAACAGAGAAGGCAGAGTGG + Intronic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181311917 22:21949540-21949562 CAGCATCAGGAATGGCATGGAGG + Intronic
1181530318 22:23513618-23513640 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1181757614 22:25035676-25035698 CAGCAGCAGCAAGGGCAAAAAGG + Intronic
1181906437 22:26200887-26200909 CAGCTTGAACAAAGGCTGAGAGG - Intronic
1181957310 22:26597301-26597323 CACCATGAACAAAGGCATAGAGG - Intergenic
1181991334 22:26839207-26839229 CAGCAACGGCAAAGGCTGTGAGG + Intergenic
1182014382 22:27026738-27026760 CAGTAACTGCAAAGGCAGAAAGG + Intergenic
1182072261 22:27472055-27472077 CAATATAGGCAAAGGCAGAGAGG - Intergenic
1182387079 22:29953382-29953404 CAGCTTCAACAAGGGCAAAGAGG - Intronic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182693697 22:32181589-32181611 TAGCATGAGCAAAGGTATAGAGG - Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183327606 22:37202943-37202965 CAGCATCAGCATTATCAGAGGGG - Intergenic
1183404085 22:37621599-37621621 CAGCATCTGCAGAGACAGAGGGG - Exonic
1183519335 22:38287454-38287476 CAGCATGTGCAAAGGCCCAGAGG - Intergenic
1183756814 22:39774911-39774933 CAGCATGAGCAAAAACACAGAGG - Intronic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184089691 22:42285799-42285821 CAGCATGTGCAAAGGCCCAGAGG - Intronic
1184092694 22:42300772-42300794 GAGCAGAGGCAAAGGCAGAGAGG - Intronic
1184102402 22:42347719-42347741 CAGCGCCAGCAGGGGCAGAGGGG + Intergenic
1184407513 22:44308455-44308477 CAGCATGAGTAAAGGCCCAGAGG - Intronic
1184419871 22:44373582-44373604 CAGCAACAACAAAGAAAGAGGGG - Intergenic
1184741291 22:46430401-46430423 CTGCATCAGCCAAGGCAGGCAGG + Intronic
1185379839 22:50503291-50503313 CAGGGTCAGCTAAGGCACAGTGG + Exonic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949529043 3:4935534-4935556 CAGCAGGAGCAAAGGCCCAGAGG - Intergenic
950146996 3:10657252-10657274 CGGCATGTGCAAAGGCACAGGGG - Intronic
950205322 3:11075790-11075812 GAGCATGTGCAAAGGCACAGAGG - Intergenic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
950434846 3:12973284-12973306 CAGGATAAGCAAAGGCACTGGGG - Intronic
950507998 3:13407600-13407622 CAGCATCAGCAGAGGAATAGAGG - Intronic
950542569 3:13621067-13621089 CATGAGCAGCACAGGCAGAGGGG - Intronic
950635203 3:14309174-14309196 CAGCAAGAGCAAAGACAGGGAGG + Intergenic
950635778 3:14313464-14313486 CAGCAGCTGCAAAGGCTCAGAGG - Intergenic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
951109132 3:18781000-18781022 CAACATAAGCAAAAGCAGACTGG + Intergenic
951270303 3:20616299-20616321 CAGCATTTGCAAAAGCAGAAAGG - Intergenic
951275429 3:20679398-20679420 TAGCATGTGCAAAGGCAGAGAGG + Intergenic
952400533 3:32959361-32959383 TAGCATCTGAAAAGGCACAGTGG + Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952695204 3:36257408-36257430 CAGCATCAGCAATTGCAGTTTGG - Intergenic
952855772 3:37769654-37769676 CAGCATGTGCAAAAGCATAGAGG - Intronic
952992871 3:38847113-38847135 AGGCATCAGCAAAGTCAGAAAGG + Exonic
953628923 3:44594728-44594750 CAACATCAGCGAATGCACAGAGG + Exonic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954972507 3:54663172-54663194 CAGCCGCAGCAAGGACAGAGAGG - Intronic
955027156 3:55179546-55179568 CAGCAAATGCAAAGGCAGAGAGG + Intergenic
955056602 3:55460812-55460834 CAGCTTGAGCAAAGGCCAAGAGG - Intergenic
955073610 3:55592360-55592382 AAGCATCAGTAAAGGCTGAAGGG - Intronic
955304560 3:57816893-57816915 CAGCATAAGGAAAGACAGAGAGG + Intronic
955662355 3:61314804-61314826 CAGCATGTGCAAAGGCTCAGTGG - Intergenic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
955865355 3:63376548-63376570 CAGCAACTGCAAAGGCACTGGGG - Intronic
955888991 3:63630812-63630834 CAGCATTTACAAAGGCACAGAGG - Intergenic
956614386 3:71156556-71156578 TAGCATTTGCAAAGGCACAGAGG + Intronic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958153680 3:89725436-89725458 CCCCATCAGCAGAGGCTGAGTGG + Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
959105008 3:102055806-102055828 CAGCATAAGGAAAGTTAGAGAGG - Intergenic
959209626 3:103361022-103361044 CTCCATCAGCAACGGAAGAGAGG + Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
959995493 3:112676127-112676149 GAGCATCTGCAAAGGCACTGAGG + Intergenic
960331741 3:116368151-116368173 GAGCACCAGCAAAGGCTCAGAGG + Intronic
960529639 3:118748601-118748623 TACCATGAGCAAAGGCACAGAGG - Intergenic
961436963 3:126925916-126925938 CAGCCTCAGGAAAGGCTGACTGG - Intronic
961595443 3:128012269-128012291 CAGCATCACCACACACAGAGAGG - Intergenic
961658524 3:128456325-128456347 CAGCATCTGCAAAGGTAGAAGGG + Intergenic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962015467 3:131434802-131434824 CAGCAACAACAAAAACAGAGTGG + Intergenic
962207268 3:133445250-133445272 CAGCAGGTGCAAAGGCACAGAGG + Intronic
962360012 3:134731925-134731947 TAGCATCAGCCAAGGGAAAGGGG + Intronic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
962654171 3:137525696-137525718 CAGCAGCTGCCAAGTCAGAGGGG + Intergenic
962976131 3:140447421-140447443 CAGCACCTGAAAAGTCAGAGCGG - Intronic
963004058 3:140709600-140709622 CAGCATGAAGAAAGGTAGAGGGG + Intergenic
963016300 3:140827564-140827586 CAGCATGAGTAAAGGCCTAGAGG + Intergenic
963281500 3:143388974-143388996 CGGCATGGGCAAAGGCATAGGGG + Intronic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963464417 3:145660687-145660709 CAGCATGTGCAAATGCACAGAGG - Intergenic
963489238 3:145978240-145978262 TAGCATGAGCAAAGGAAGACAGG - Intergenic
963581258 3:147129325-147129347 CACCATCAGCAAAGAAAGATGGG - Intergenic
963853953 3:150235293-150235315 CAGCATGGGCAAAGGCAGATTGG - Intergenic
963970645 3:151425948-151425970 GAACATCTGCAAAGGCACAGAGG + Intronic
964434074 3:156634033-156634055 CAGCAGGAGCAAAGACACAGAGG + Intergenic
964483536 3:157164384-157164406 CAGCTTCAACAAAGGTGGAGGGG + Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
964697289 3:159523991-159524013 CTGCATCAGGAAATGCTGAGTGG - Intronic
964798099 3:160521865-160521887 CAGCATCAGTAAGGTAAGAGAGG + Exonic
964848131 3:161065913-161065935 CAGCACTTGCAAAGGCACAGAGG - Intronic
964994785 3:162865700-162865722 TACCATCAGCAAAGACTGAGTGG - Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966767935 3:183479146-183479168 CAGCATCATCCAGGGCACAGAGG + Intergenic
966821073 3:183924994-183925016 CCGCACCTGCAAAGGAAGAGTGG + Intronic
966921341 3:184613607-184613629 CAGGATGTGCAAATGCAGAGAGG + Intronic
967399489 3:189044652-189044674 GAGCATAAGCAAGGGCAAAGGGG + Intronic
967464981 3:189794521-189794543 AAGCATCAGCAAAGGGAAGGGGG + Intronic
967758139 3:193193485-193193507 CAGCTTCAGCAGAGGAACAGAGG - Intergenic
967822884 3:193854674-193854696 CAGGATCAAGAAAGCCAGAGGGG - Intergenic
968382584 4:108642-108664 CAACATGTGCAAAGGCACAGGGG + Intergenic
968403341 4:317248-317270 CAGCATGTGCAAAAGCACAGCGG - Intergenic
968568707 4:1328294-1328316 CGGCGTCTGCAAAGGAAGAGAGG + Intronic
968969184 4:3784585-3784607 CCTCATCAGCAAAGCCAGGGAGG + Intergenic
969037801 4:4269388-4269410 CCGCACCAGCAAAAGCCGAGTGG + Intronic
969061225 4:4436869-4436891 CAGCATGAGCAAATGCTCAGAGG - Intronic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
969182502 4:5452956-5452978 CAGCATCAGTACAAGCAGACAGG + Intronic
969228589 4:5814716-5814738 CATCATGAGCAAAGGCCCAGTGG - Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969377381 4:6771777-6771799 CAGCATTTGCAAAGGCAGAGAGG + Intergenic
969463487 4:7341262-7341284 CAGCATGTGCAAAGGCCCAGGGG - Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
969701038 4:8767959-8767981 CAGCCGCTGCAAAGGCACAGAGG - Intergenic
969919323 4:10522930-10522952 CAGCATGTGCAAAGGCCCAGAGG + Intronic
970422483 4:15918517-15918539 CAGCATGAGCAAGGGCTCAGAGG - Intergenic
970538325 4:17052720-17052742 CAGCATGTGCAAAGGCCCAGGGG + Intergenic
971036909 4:22703709-22703731 CAGCATGTGCAAAGGTACAGAGG - Intergenic
972125529 4:35760621-35760643 CTGCAGCAGCACTGGCAGAGGGG - Intergenic
972596810 4:40536680-40536702 CAAAAACTGCAAAGGCAGAGAGG - Intronic
972828355 4:42786965-42786987 CTGCAGCAGCAATGGCAGAAGGG + Intergenic
973120414 4:46514920-46514942 CAGCATCAGCGCAGGCTGAAAGG + Intergenic
973241005 4:47955592-47955614 GAGCATATGCAAAGGCACAGAGG - Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
973743139 4:53937467-53937489 CAGCCTCCTCCAAGGCAGAGAGG + Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
974714612 4:65651105-65651127 CAGCAACATCAAAGGCAGTCAGG - Intronic
975487248 4:74948020-74948042 TGGCATGAGCAAAGGCAGAGAGG - Intronic
975525898 4:75350521-75350543 CTGCAGCAGCAAAGGCTGTGGGG - Intergenic
975695778 4:77011479-77011501 CAGCGTGAGCAAAGACACAGAGG + Intronic
976102444 4:81580393-81580415 CAGCATCAGCCAGCCCAGAGAGG - Intronic
976793941 4:88911588-88911610 CAACAACAGGGAAGGCAGAGAGG - Intronic
977002268 4:91519027-91519049 CTGCATCTGCAATGGCAAAGGGG + Intronic
978090177 4:104706409-104706431 CAGAAACAGAGAAGGCAGAGTGG + Intergenic
978210206 4:106126077-106126099 CAACATGTGCAAAGGCACAGTGG - Intronic
978271274 4:106893461-106893483 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
978384665 4:108167812-108167834 CAACAGCAGGAAAGACAGAGGGG + Exonic
978757799 4:112323060-112323082 CAGCAAGAGCAAAGACACAGAGG - Intronic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979720711 4:123896880-123896902 CAGCATGTCCAAAGGCACAGAGG + Intergenic
980159419 4:129141376-129141398 CAGAATGAACAAAGGCACAGAGG + Intergenic
980162994 4:129188995-129189017 AAGCATAAGCAAAGGCTCAGAGG + Intergenic
980796421 4:137690004-137690026 TAGCATGTGCAAAGGCACAGAGG + Intergenic
980905430 4:138944081-138944103 CAGTAAGAGCAAAGGCACAGAGG + Intergenic
981337229 4:143581298-143581320 CTGCAGCTGCAATGGCAGAGAGG - Intronic
981911574 4:149987520-149987542 CAGCAACAGGAAATGCAGAAAGG - Intergenic
982178770 4:152730879-152730901 CAGCATGTGCAAAGGCCTAGAGG + Intronic
982329067 4:154161162-154161184 CAGCATGAGAAAAGGGGGAGGGG + Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
984437849 4:179726779-179726801 CAGAGTCAGCGAAGGCAGATAGG - Intergenic
985477859 5:89981-90003 CAGGACCTGTAAAGGCAGAGGGG - Intergenic
986165120 5:5266417-5266439 AAGCAAAAGCAACGGCAGAGTGG + Intronic
986637209 5:9835170-9835192 CAGCATCTGGAAAGGCCAAGGGG + Intergenic
986820621 5:11462440-11462462 CCACAACAGCAAAGGCAGGGAGG - Intronic
987143262 5:14966612-14966634 CTCCATCAGCAAAGGCCAAGAGG - Intergenic
987555232 5:19437739-19437761 TACCATGAGCAAAGGCACAGAGG - Intergenic
988190381 5:27923243-27923265 CAACCTCAGCAAAGGGAGAAAGG - Intergenic
988865048 5:35324992-35325014 CAGCAGCAGCAATGGCAGCATGG - Intergenic
989479241 5:41910158-41910180 CAGCATCTGCAAAAGTAAAGGGG - Intronic
989615403 5:43333087-43333109 GAGCATCAGCAAAGGGAGATGGG + Intergenic
990363777 5:55048406-55048428 CAGCATGAACAAAGCCACAGAGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
991131978 5:63132918-63132940 CACCACCAGCAAGGGCAGAAAGG - Intergenic
991299054 5:65110630-65110652 CAGCATAAGCAAGGTGAGAGAGG + Intergenic
991406479 5:66305406-66305428 CAGCATGTGCAAGGGCACAGAGG + Intergenic
991473355 5:66993640-66993662 CAGGATGTGCAAAGGCAGTGAGG + Intronic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992553640 5:77882941-77882963 CATGATCAGCACAGGCAGAAAGG - Intergenic
992718619 5:79536292-79536314 CAATATAAGGAAAGGCAGAGAGG + Intergenic
992879176 5:81088189-81088211 CAGCACAAGGAAAGGCACAGAGG - Intronic
993011827 5:82492002-82492024 AAGCAGAAGCAAAGGTAGAGGGG - Intergenic
994261676 5:97666474-97666496 CAGTATCTGCAAAGGCAGCACGG + Intergenic
994396567 5:99230078-99230100 TAGAATCAGCAAAGGGAGATAGG - Intergenic
994559408 5:101347783-101347805 CAGCTGCAGCAAAAGCAGATGGG - Intergenic
994644407 5:102450937-102450959 CTACAGCAGCAAGGGCAGAGGGG + Intronic
994794054 5:104270845-104270867 TAGCATGAGCAAATGCAGAGAGG + Intergenic
994948161 5:106423243-106423265 CAGCACCAGCAGAGGGTGAGAGG - Intergenic
995674075 5:114642689-114642711 CAAAATCAGCAAAGGGAGAATGG - Intergenic
995867664 5:116708735-116708757 CACCTTCAGCAAAGGAAAAGTGG + Intergenic
996092144 5:119361870-119361892 CAGCAGCAGGCAAGGGAGAGGGG - Intronic
997139585 5:131364390-131364412 GAACATCAGAGAAGGCAGAGTGG + Intronic
997258057 5:132444290-132444312 CAGCATAAGCTGAGGCAAAGGGG - Intronic
997533769 5:134599815-134599837 CAGCATCAGAAAAAGCTGAGAGG + Intergenic
997749831 5:136333329-136333351 CAGCGTAAGTAAAGGCACAGAGG + Intronic
997949562 5:138231301-138231323 CAGCCACACCAAAGGCAAAGTGG + Intergenic
998182336 5:139954251-139954273 CAGCAGCAGCCAAGCCAGAGAGG + Intronic
998551766 5:143084716-143084738 TGGCATAAGCAAAGGCAAAGAGG - Intronic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998625457 5:143840889-143840911 GAGCATCAGTAAAGGCAGCTGGG + Intergenic
998854285 5:146379361-146379383 CAGCAGCAACAAAGGCAAAGAGG + Intergenic
998895207 5:146791642-146791664 TAGCATCTGCAAAAGCACAGAGG - Intronic
999085454 5:148884759-148884781 CAGCATGAGCAAAGACTGAGTGG - Intergenic
999190187 5:149741478-149741500 CTGCTTCTGCAAAGGCAGGGTGG - Intronic
999228556 5:150047707-150047729 CAGCACCTGCTAAGGCAGTGTGG + Exonic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
999714488 5:154349193-154349215 CAGCATAAGCAAAAGCACTGAGG + Intronic
999811219 5:155129126-155129148 CAGCATCTGCAAAGGCTAAAAGG - Intergenic
1000102864 5:158033622-158033644 CAGCATCCCCAGAGCCAGAGTGG + Intergenic
1000286783 5:159833705-159833727 CAGCAAGAGCAAAGGCACTGAGG + Intergenic
1001149554 5:169215239-169215261 CAACATCAGCAAAGGCCCAGAGG - Intronic
1001298460 5:170515961-170515983 CAGGATAAGCAAAGTCACAGAGG + Intronic
1001319918 5:170672124-170672146 CAGCATATGCAAAGGCTCAGAGG + Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001421531 5:171591010-171591032 CAGCACCAGCAAAGGCAAGAAGG - Intergenic
1001465666 5:171963337-171963359 TAGCATAAGCAAAGCCAAAGAGG + Intronic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1001949491 5:175806265-175806287 CAGCATCTGCAAAGACACGGGGG - Intronic
1001951280 5:175818256-175818278 CACCATGGGCAAAGGCATAGAGG + Intronic
1001966578 5:175914020-175914042 CTGCATGGGCAAAGGCACAGAGG - Intergenic
1002038522 5:176492609-176492631 CGGCAAAAGCAAAGGCACAGAGG - Intronic
1002062156 5:176631563-176631585 CAGCATGGGCAAAGGCACTGTGG + Intronic
1002250369 5:177925184-177925206 CTGCATGGGCAAAGGCACAGAGG + Intergenic
1002566530 5:180115322-180115344 TAGCATCAAGAAAGACAGAGGGG - Intronic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003805205 6:9720654-9720676 CATCATCAGCAAAGGCCTTGTGG - Intronic
1004202062 6:13558153-13558175 CATCCTCAGCAGAGACAGAGTGG + Intergenic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004372844 6:15067356-15067378 CAGAGCCACCAAAGGCAGAGAGG + Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1005306864 6:24522345-24522367 CAGCAACAGCAGAGGCTAAGAGG - Intronic
1005951656 6:30636263-30636285 AGGCATGAGCAAAGGCAGAAAGG + Intronic
1006037151 6:31222878-31222900 GAGCATCAGCCAGGGCAGGGGGG - Intergenic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006177922 6:32134335-32134357 CTGCAACACCAAAGGAAGAGAGG - Intergenic
1006367579 6:33624613-33624635 CAGCCTCGGGAAAAGCAGAGGGG - Intronic
1006390131 6:33753526-33753548 CAGCATCCACAAAGGCCCAGAGG + Intergenic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006786295 6:36669533-36669555 AAGCCTCAGCATAGGCTGAGGGG - Intergenic
1006818754 6:36873715-36873737 CAGCATGAGCAAATAGAGAGAGG + Intronic
1006903630 6:37518620-37518642 CAGCAAGTGCAAAGGCAAAGAGG - Intergenic
1007084980 6:39137219-39137241 TAGCATGAGAAAAAGCAGAGTGG + Intergenic
1007251832 6:40500453-40500475 CAGAATCAACAAGGGCTGAGAGG - Intronic
1007300101 6:40861492-40861514 GAGAATCAGCAAAGGGAGAGAGG + Intergenic
1007506286 6:42337726-42337748 TAGCATAAGCAAAGGCATGGAGG + Intronic
1007894993 6:45345930-45345952 CAGCATGATCAAAGACACAGAGG - Intronic
1007917577 6:45575408-45575430 CAGGATTAGCCAGGGCAGAGTGG - Intronic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1008496031 6:52135420-52135442 CAGCTTGAGCAAAGACATAGTGG - Intergenic
1008675106 6:53810803-53810825 CAGCACCAAGAAAGGCACAGAGG - Intronic
1009975519 6:70667500-70667522 CAGCAAGAGCAAAGGCAAATGGG + Intergenic
1010148799 6:72705056-72705078 TAGATTGAGCAAAGGCAGAGAGG - Intronic
1010354451 6:74915087-74915109 CAGCACATGCAAAGGCAGAGAGG - Intergenic
1010465884 6:76166343-76166365 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1010762123 6:79735420-79735442 CAGCCTATGCAAAGGCACAGAGG - Intergenic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011242448 6:85287194-85287216 CAGCATCAGTAAGGTAAGAGAGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1013521718 6:110939544-110939566 CAGCATTAGCAAAGGCCCAGTGG + Intergenic
1014499714 6:122171033-122171055 CAGTATCAGGAATGGAAGAGGGG + Intergenic
1014572486 6:123027016-123027038 CAGCATGAGCTAAGGTACAGAGG + Intronic
1015606707 6:134963753-134963775 CAGCACCAGGGAAGGCAGAGTGG + Exonic
1015946631 6:138508640-138508662 TAGCATGTGCAAAGGCATAGAGG - Intronic
1016116270 6:140290159-140290181 CAGGACCAGCAAAGGATGAGGGG - Intergenic
1016172975 6:141041966-141041988 CAGCCTCAGCAAGCCCAGAGAGG + Intergenic
1016506505 6:144786618-144786640 AAGCCTGAGCAAAGGCACAGAGG - Intronic
1017083603 6:150692901-150692923 TAGCATAAGCAAAGGCACAGAGG + Intronic
1017190446 6:151648196-151648218 CAGCATCAGCTATGGTAGTGTGG + Intergenic
1017418682 6:154249640-154249662 TGGGATCAGCCAAGGCAGAGAGG + Intronic
1017561572 6:155633790-155633812 CAACAGAAGCAAAGGCATAGAGG - Intergenic
1018146884 6:160900073-160900095 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1018908867 6:168090449-168090471 CAGCATGTGCAAAGGCCCAGGGG - Intergenic
1018941147 6:168309493-168309515 CAGGATCAGAACAGGCTGAGGGG - Intronic
1019091002 6:169533569-169533591 CAGAAACAGAAAAGGCAGAGAGG + Intronic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019748955 7:2716891-2716913 GAGCCTCAGAAACGGCAGAGCGG + Intronic
1020016841 7:4836216-4836238 CAGCCTCGGCACAGCCAGAGGGG + Intronic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1021416638 7:20393714-20393736 CAGCAAGAACAAAGGCACAGAGG - Intronic
1021630894 7:22646583-22646605 CAGCAGCAGCAAAGGCTGTTGGG + Intergenic
1021800930 7:24305633-24305655 GAGCATGAGCGAGGGCAGAGTGG + Intergenic
1022112258 7:27239091-27239113 CAGCAGCTGCCAAGGCAGAAGGG + Intergenic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022597713 7:31728472-31728494 CAGCATAGGCAAAAACAGAGGGG - Intergenic
1022951919 7:35347324-35347346 AATAAGCAGCAAAGGCAGAGTGG + Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023464108 7:40434859-40434881 CAGCATCAGAAAAAGCATAGGGG - Intronic
1024019307 7:45350953-45350975 CAGTATCAACAAAGGCTGAATGG - Intergenic
1024414785 7:49094107-49094129 AAGCCTCAGCAAAGACACAGTGG + Intergenic
1024589385 7:50867956-50867978 CAGATGCAGCAAAGGCAGTGAGG + Intergenic
1024921100 7:54555433-54555455 CAGCATTTGCAAAGCCATAGAGG - Intronic
1025233025 7:57215520-57215542 CAGCATGTGCAAAGGCCTAGCGG + Intergenic
1026390328 7:69894812-69894834 AAGCATGAGCAAATGAAGAGTGG - Intronic
1026434418 7:70382624-70382646 CACAATGGGCAAAGGCAGAGTGG - Intronic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1027050532 7:75018765-75018787 CAGCATGTGCAAAGGCCCAGGGG + Intronic
1027770656 7:82402199-82402221 CAGCATATGCAAAGTCAGAGAGG + Intronic
1028724973 7:94076448-94076470 CATCATCTGAAAAGGCACAGTGG + Intergenic
1029031016 7:97467073-97467095 CTGCATCAGTAAACGCATAGAGG + Intergenic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029236725 7:99125959-99125981 TAGCATAAGCGAAGACAGAGTGG - Intronic
1029303535 7:99602281-99602303 CAGGCTCAGCACAGACAGAGGGG + Intronic
1029382513 7:100222905-100222927 CAGCATGTGCAAAGGCCCAGGGG - Intronic
1029941096 7:104481509-104481531 CAGCATAAGCAAAGGCCCAGAGG - Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030161151 7:106509810-106509832 CAGCATAAGCAAAGGTGCAGAGG + Intergenic
1030741383 7:113113926-113113948 CACCATCAGCAAAGGTTGAGTGG + Intergenic
1030747377 7:113183595-113183617 CAGCATGTGCAAAGGCTCAGAGG + Intergenic
1031800601 7:126239479-126239501 CAACACCAGCAAAAGTAGAGAGG + Intergenic
1032020474 7:128405031-128405053 GAGCATCAGAAGGGGCAGAGTGG - Intronic
1032069680 7:128796328-128796350 CAGCAACTGCAAAGGCCCAGAGG + Intronic
1032421446 7:131783052-131783074 CAACATTAGCAAAGGCCAAGAGG + Intergenic
1032532598 7:132634595-132634617 CAGCATGTGCAAAGGCCCAGGGG - Intronic
1032655779 7:133928392-133928414 AGGCATCAGCAGAGACAGAGTGG - Intronic
1032706388 7:134423963-134423985 CAGCCTGAGCCAAGGCACAGGGG + Intergenic
1032954764 7:136958284-136958306 TAGCAGCAGCGAGGGCAGAGTGG + Intronic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1033945377 7:146710063-146710085 GCCCATCAGCGAAGGCAGAGAGG + Intronic
1034402296 7:150870780-150870802 CAGCAGCATCAAGGGCAGAAAGG - Intergenic
1034625040 7:152485964-152485986 CTGCGTGAGCAAAGGCACAGAGG - Intergenic
1035078405 7:156196688-156196710 CTGCATCAGCAAACGCTCAGAGG + Intergenic
1035078421 7:156196789-156196811 CTGCATCAGCAAACGCTCAGAGG + Intergenic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1036540667 8:9705563-9705585 CAGCACCAGAAAAAGCAGATTGG - Intronic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037996980 8:23359860-23359882 CAGCATGGGCAGAGGCACAGAGG - Intronic
1038608190 8:29031977-29031999 CACCATGTGCAAAGGCACAGAGG + Intronic
1038609137 8:29043251-29043273 CAGCATGTGCAAAGGCAAAATGG - Intronic
1039659381 8:39446604-39446626 CAGCTTCAGGGAAGACAGAGTGG + Intergenic
1039700208 8:39954323-39954345 GGGCACCAGCAAAGGCACAGAGG - Intronic
1040533457 8:48284829-48284851 CAGCATCCACATAGGAAGAGAGG + Intergenic
1041008015 8:53514756-53514778 CAGCCTCAGCAGAGCCACAGTGG + Intergenic
1041150028 8:54922558-54922580 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1041732351 8:61075417-61075439 CAACATCTGCAAAGGCTGAAAGG + Intronic
1042471720 8:69197130-69197152 CAGCATAAGCAAAGACAGTGGGG - Intergenic
1042771522 8:72387757-72387779 CAGCAGCAGCAAAGGGACACAGG + Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1044302257 8:90598368-90598390 CAGCAACGTCAAAGGCTGAGGGG + Intergenic
1044587952 8:93885389-93885411 TAACATGAACAAAGGCAGAGGGG + Intronic
1044627232 8:94245931-94245953 TAGCATGAGCAATGACAGAGAGG - Intergenic
1045036005 8:98176942-98176964 CAGCATTAGCTAAGACAGACAGG + Intergenic
1045158168 8:99503524-99503546 CAGCAGCAGCAAAGTTTGAGAGG - Intronic
1045213630 8:100124825-100124847 CAGCATTGGCAAAGGCAAGGAGG + Intronic
1045293139 8:100850798-100850820 CAGCATCAGCAAAAGCTGCCTGG - Intergenic
1045480537 8:102588079-102588101 CAGCATGAACAAAGACATAGAGG + Intergenic
1046109239 8:109701972-109701994 CACCATGTACAAAGGCAGAGCGG + Intergenic
1046222651 8:111236147-111236169 CTGGATCACCTAAGGCAGAGAGG - Intergenic
1046285868 8:112092361-112092383 CAGCAGTGGCAATGGCAGAGGGG + Intergenic
1046794336 8:118354416-118354438 TAGCATGAGCAAAGGCTGGGAGG - Intronic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047521922 8:125601569-125601591 CAGCATTTGCAAAGGCACAGAGG + Intergenic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048475478 8:134738783-134738805 CAGCATGTGCAAAGGCCCAGGGG + Intergenic
1048813842 8:138312671-138312693 CCACACCAGCAAAGGCAAAGTGG + Intronic
1049214964 8:141403293-141403315 CAGCATCAGCAACACCAGGGAGG - Intronic
1049271561 8:141698830-141698852 CAGCAACATCATAGGCAGAGAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049429603 8:142554365-142554387 CTGCATCAGCAAGGGTACAGAGG - Intergenic
1049495090 8:142926328-142926350 CAGGGACAGCAAAGGCATAGAGG - Intergenic
1049602355 8:143513842-143513864 CAGCCTCAGCAAAGGCTGTGAGG - Intronic
1049842941 8:144785868-144785890 GTCCATCAGCAAAGTCAGAGTGG + Intronic
1049922570 9:379061-379083 CAGCATGAGCAAAGTCTCAGAGG + Intronic
1050431713 9:5569004-5569026 CACTAACAGGAAAGGCAGAGAGG + Intronic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051205164 9:14680994-14681016 CAGAATAAGCAAAGGCATAAAGG + Intronic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054790371 9:69251097-69251119 CATTACCAGCAACGGCAGAGGGG - Exonic
1054846594 9:69805296-69805318 CAGCATTAGAAAAGGCAAGGAGG - Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055641924 9:78325496-78325518 CTGCATCTGCAAAGGCACAAAGG - Intronic
1056090958 9:83205454-83205476 CAGCATGAGCATAGTCACAGAGG - Intergenic
1056286214 9:85090421-85090443 CAGCATCTGCAAAGACTGAAAGG + Intergenic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056521421 9:87405208-87405230 CAGCATGAACCAAGGCACAGAGG - Intergenic
1056522069 9:87411029-87411051 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
1056547553 9:87625443-87625465 TAGCATCACTAAATGCAGAGTGG + Intronic
1057366063 9:94422277-94422299 CAAAATCAGCAAAGGCAAAAGGG - Intronic
1057657269 9:96965788-96965810 CAAAATCAGCAAAGGCAAAAGGG + Intronic
1057828778 9:98391660-98391682 CAGCATGAGCCAAGGCCCAGTGG + Intronic
1057886668 9:98834846-98834868 CAGCATGAGCAAAGGCTTAAGGG - Intronic
1058003446 9:99890720-99890742 TAGCTTGAGCAAAGGCATAGAGG + Intergenic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1059322562 9:113481009-113481031 CAGCAGGTGCAAAGGCACAGAGG - Intronic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059377039 9:113890429-113890451 CATCATCAGCAAATGTAGATAGG + Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059519531 9:114927443-114927465 CAGCATGAGCAAAGAGACAGAGG - Intronic
1059541446 9:115134423-115134445 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1059687653 9:116652883-116652905 CAGAGTGAGCAAAGGCACAGAGG - Intronic
1059918052 9:119125735-119125757 CAGAATGAGCAAAGACACAGAGG - Intergenic
1060100308 9:120834506-120834528 CAGCACATGAAAAGGCAGAGAGG + Intronic
1060528650 9:124334709-124334731 CAGCACGTGCAAAGGCACAGAGG + Intronic
1060656133 9:125374062-125374084 GGGCATCAGCAAAGGCTTAGAGG - Intergenic
1060770976 9:126332115-126332137 CAGCCTCAACAAAGGCACCGTGG - Intronic
1060775741 9:126372891-126372913 CAACACGAGCAAAGGCAGGGAGG + Intronic
1060880857 9:127117085-127117107 CAGCACATGCAAAGGCAGGGAGG - Intronic
1061046634 9:128168785-128168807 CAGCATCAGTAAAGGCACGGAGG - Intronic
1061105755 9:128529159-128529181 TAGCAACAGCAAAGCAAGAGAGG + Intronic
1061219411 9:129241696-129241718 CAGCGTCACCAAAGGCAGAGGGG - Intergenic
1061482871 9:130905788-130905810 CAGCATGTGCAAAGGCCCAGAGG - Intronic
1062203481 9:135321555-135321577 CAGAATGAGCCACGGCAGAGTGG - Intergenic
1062543238 9:137050750-137050772 GAGCATGAGCAAAGGCCCAGTGG - Intronic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1185865622 X:3621366-3621388 CAACATCAGCAAACGCAGCATGG + Intronic
1186594996 X:10971285-10971307 CAGCATTTACAAAGGCAGTGGGG - Intergenic
1187367994 X:18680193-18680215 CAGCAGCAGCAAAGGCCCCGAGG - Intronic
1187453912 X:19424081-19424103 TAAAATCAGCAAAGGCAGAAAGG - Intronic
1187637481 X:21246754-21246776 CAGGATTAGCAAAGACAAAGAGG + Intergenic
1187667099 X:21626268-21626290 TGGCATCAGCAAAGGTAGACAGG + Intronic
1187797579 X:23021174-23021196 CAGCATGACCAAAGTCAGAATGG + Intergenic
1188090010 X:25952889-25952911 CCGCATCAGCTCAGGCACAGGGG + Intergenic
1188992622 X:36841180-36841202 CAGCTTCAGCATTGGCAGAAAGG - Intergenic
1189155733 X:38755253-38755275 TATCAACAGCAAAGGCACAGAGG + Intergenic
1189222057 X:39381113-39381135 CAGCATATGCAAAGGCCCAGAGG + Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1190577718 X:51857956-51857978 CAGCATCAGAAAATACAGAGTGG + Intronic
1190744261 X:53312126-53312148 CAGCATGAGCAAACACACAGAGG - Intronic
1190792949 X:53716796-53716818 TGGCATCATCAAAGGCACAGGGG - Intergenic
1190890129 X:54560566-54560588 CATCATCAGCATTGCCAGAGAGG - Exonic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1190937668 X:55011020-55011042 CAGCATGAGCAAAGTCCCAGAGG + Intronic
1191683804 X:63868581-63868603 CAGCCTAAGTAAAGGCACAGAGG - Intergenic
1191741786 X:64443934-64443956 CAGCATCAGAAAAGGCAGTGGGG + Intergenic
1191753333 X:64567370-64567392 CAGCATAAGCAAAGGCACAAAGG - Intergenic
1192152306 X:68719839-68719861 CAGCACAAACAAAGGCAAAGAGG - Intronic
1192197057 X:69035403-69035425 CAGCATGTGCAAAGGCCCAGAGG - Intergenic
1192233206 X:69279817-69279839 CAGCATGAGGGAAGGCACAGAGG - Intergenic
1192782733 X:74310290-74310312 CACCACCAGCAAAGGCCTAGTGG + Intergenic
1192929132 X:75786238-75786260 CAGCAACAGGAAAGGCCTAGAGG + Intergenic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194627855 X:96246990-96247012 AAGTATAAGCAAGGGCAGAGAGG + Intergenic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1195694585 X:107657350-107657372 CCGCACCAGCAAAGCCTGAGTGG - Intergenic
1195939158 X:110153058-110153080 CAGCATTTTCAAAGGCACAGAGG - Intronic
1196093905 X:111777718-111777740 CAGCATAGGCAAAGGCCCAGAGG - Intronic
1196245191 X:113391740-113391762 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic
1196505230 X:116434498-116434520 TAGCATGAGCAAAGGCACTGAGG + Intergenic
1196757198 X:119168345-119168367 CAGCATGAGCAAAGTCCTAGAGG - Intergenic
1197172366 X:123448530-123448552 CAGCTTAAGGAAAAGCAGAGAGG - Intronic
1197629102 X:128837400-128837422 CAACAAAAGCAAAGGCACAGAGG - Intergenic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1197779390 X:130144507-130144529 CAGCATAAGCAAAAGCACAAGGG - Intronic
1197913883 X:131514135-131514157 CCGCAGCTGCAATGGCAGAGGGG + Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1199770575 X:150972790-150972812 CAGAGCCAGCAAAGGCTGAGAGG - Intergenic
1199824409 X:151484206-151484228 CAGCAACAGCAATGGTACAGAGG - Intergenic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1202132482 Y:21626007-21626029 CAGCAGTTGCAAAGGCAGAAAGG - Intergenic