ID: 1055024042

View in Genome Browser
Species Human (GRCh38)
Location 9:71700255-71700277
Sequence CTTGTAAGATAGCCTAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055024040_1055024042 15 Left 1055024040 9:71700217-71700239 CCACAGTTACACAGTGATTTTCA 0: 1
1: 0
2: 3
3: 34
4: 672
Right 1055024042 9:71700255-71700277 CTTGTAAGATAGCCTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055024042 Original CRISPR CTTGTAAGATAGCCTAAGTC AGG Intronic
No off target data available for this crispr