ID: 1055024305

View in Genome Browser
Species Human (GRCh38)
Location 9:71703126-71703148
Sequence GGGGACTGCTCCACGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055024295_1055024305 18 Left 1055024295 9:71703085-71703107 CCACAATGTGGACTAAGGATTGG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1055024305 9:71703126-71703148 GGGGACTGCTCCACGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055024305 Original CRISPR GGGGACTGCTCCACGGAGCC AGG Intronic
No off target data available for this crispr