ID: 1055030953

View in Genome Browser
Species Human (GRCh38)
Location 9:71770770-71770792
Sequence TTGTAAGCTACACTGAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055030951_1055030953 4 Left 1055030951 9:71770743-71770765 CCAGAAGTGTGAAAGAATAAACT 0: 1
1: 11
2: 108
3: 748
4: 2833
Right 1055030953 9:71770770-71770792 TTGTAAGCTACACTGAGTTTGGG No data
1055030950_1055030953 11 Left 1055030950 9:71770736-71770758 CCTGCTTCCAGAAGTGTGAAAGA 0: 1
1: 2
2: 60
3: 754
4: 3705
Right 1055030953 9:71770770-71770792 TTGTAAGCTACACTGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055030953 Original CRISPR TTGTAAGCTACACTGAGTTT GGG Intronic
No off target data available for this crispr