ID: 1055033206

View in Genome Browser
Species Human (GRCh38)
Location 9:71791402-71791424
Sequence CTGCCTGTCATTACCAGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055033206_1055033210 1 Left 1055033206 9:71791402-71791424 CCGGAGCTGGTAATGACAGGCAG 0: 1
1: 0
2: 1
3: 18
4: 144
Right 1055033210 9:71791426-71791448 ACTGGCCATGGATGTTTTGGAGG No data
1055033206_1055033209 -2 Left 1055033206 9:71791402-71791424 CCGGAGCTGGTAATGACAGGCAG 0: 1
1: 0
2: 1
3: 18
4: 144
Right 1055033209 9:71791423-71791445 AGAACTGGCCATGGATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055033206 Original CRISPR CTGCCTGTCATTACCAGCTC CGG (reversed) Intronic
900597884 1:3490733-3490755 CAGCCTGTCCTTCCCAGCTCTGG + Intronic
902075824 1:13784788-13784810 ATGCCTGTCATTACCATCTACGG - Intronic
906521990 1:46472798-46472820 TTGCCTGTCCTTTCCAGATCTGG + Intergenic
907229362 1:52981294-52981316 GTGGCTGTCATTATCAGCACAGG - Intronic
911048702 1:93651183-93651205 CTGCTTGTCAGTAACAGCTTAGG + Intronic
915357584 1:155264877-155264899 CTGCCTGGCCTTACAAGCCCTGG + Intronic
918045661 1:180939518-180939540 CTGCAAGTCCTTGCCAGCTCCGG + Intronic
918050576 1:180969393-180969415 CTTCCTGTGCTTCCCAGCTCAGG - Intergenic
918146226 1:181758338-181758360 CTGCCTCCCATTGCCATCTCAGG - Intronic
922924867 1:229340400-229340422 GTGCCTGTATTTACCAGCTCAGG - Intronic
1065357210 10:24853822-24853844 CTGCCTGCATTTACCAGCTAAGG - Intronic
1065499109 10:26361597-26361619 GTACCTGTCAGTATCAGCTCTGG + Intergenic
1065903823 10:30230721-30230743 GTGTCTGTCATTTCCAGGTCTGG - Intergenic
1070326564 10:75393383-75393405 GTGCCTGTCACTTCCAGCTAGGG - Intergenic
1070598420 10:77849050-77849072 CTGCCTGGCATCCCCATCTCTGG - Intronic
1071015960 10:80997461-80997483 CTGCCTGTGAGTCCCTGCTCAGG + Intergenic
1072770044 10:98130266-98130288 CTGGCTCTAATTACCACCTCAGG + Intergenic
1075006073 10:118831058-118831080 CTGCCTGAGATTCCCAGCTGGGG - Intergenic
1076026935 10:127123210-127123232 GGGGCTGTCATTACCTGCTCAGG + Intronic
1078547305 11:12255742-12255764 GTGCATGTCCTTACCAGGTCTGG - Exonic
1081573900 11:44307713-44307735 CTGGCTGTCCTTCCCAGCCCAGG - Intronic
1083709328 11:64538607-64538629 CTGCCTGCCATAACCAGCACAGG - Intergenic
1089566919 11:119376484-119376506 ATGCCTGTACTTGCCAGCTCTGG - Intronic
1090027711 11:123181902-123181924 CTGCCTGTCATTCCCTCCCCTGG + Intronic
1090084380 11:123638489-123638511 CTGACTGTCATCAGCTGCTCAGG + Intronic
1090621819 11:128567259-128567281 CTGTCAGTCATTGCCAGCTCTGG - Intronic
1092275540 12:7058252-7058274 CTTCCTGGCATTACTGGCTCTGG + Intronic
1098152487 12:67561437-67561459 CTGCCTGTCTTAGTCAGCTCAGG + Intergenic
1098549893 12:71751603-71751625 CTTCTTGTCTTTTCCAGCTCTGG + Intergenic
1100442350 12:94628450-94628472 GTGCCTGTCATTGGTAGCTCTGG - Intronic
1101023588 12:100578320-100578342 CTGCCTGTGTTTACCATCTCAGG - Intronic
1101086976 12:101246206-101246228 GGGCCTGGCATTACCAGCACAGG + Intergenic
1104926938 12:132318736-132318758 CTGCCTGGCAATCCCAGCTGTGG + Intronic
1108046514 13:46388639-46388661 CTACGTGTCATTACCAGTGCAGG - Intronic
1109238450 13:59852867-59852889 CTGCCTGTCATTAACAGTGCAGG - Intronic
1112090095 13:96074033-96074055 CTACCTCTAATTACCACCTCAGG - Intergenic
1115455857 14:33601580-33601602 ATGACTGTCATTAAGAGCTCTGG - Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117552249 14:56848082-56848104 GTTCCTCTCATTCCCAGCTCAGG - Intergenic
1119405479 14:74396118-74396140 CTGGCTGTCATCCCCAACTCAGG + Intergenic
1121330967 14:93049666-93049688 CTGGCTGGCATCCCCAGCTCTGG - Intronic
1121969062 14:98339717-98339739 CTCCCTGTCTTTTCCAGCTTTGG - Intergenic
1122743265 14:103883727-103883749 CTGTCTGTCATGACCTCCTCTGG + Intergenic
1122746448 14:103899816-103899838 CTGCCTGTCCTGGCCGGCTCAGG - Intergenic
1122772901 14:104105128-104105150 CTCCCTGGCCCTACCAGCTCAGG - Intronic
1127204567 15:56700717-56700739 CTGCCTGTTATTAACAGGTTGGG + Intronic
1132654895 16:1037654-1037676 CTTCCTGGCACTACCAGCTCAGG - Intergenic
1136945630 16:34648058-34648080 CTCCTGGTGATTACCAGCTCTGG + Intergenic
1139954763 16:70687823-70687845 CTGCCTGTCAGGACCAGGGCTGG - Exonic
1140189157 16:72800098-72800120 CTGCTTGGCATCACCATCTCAGG + Exonic
1140408184 16:74724876-74724898 ATGCCACTCAGTACCAGCTCCGG - Intronic
1141962758 16:87420555-87420577 CAGCCTGTCCTTGCCAGCTGTGG + Intronic
1141992667 16:87619612-87619634 CTGGCTCTGCTTACCAGCTCCGG + Intronic
1150943897 17:69723632-69723654 CTCCCAGTGATTACCTGCTCTGG + Intergenic
1153987936 18:10369282-10369304 CTGCCTCTCATTATCAACTCTGG + Intergenic
1155056150 18:22185499-22185521 CTGACTGCCATTACCAGGGCAGG + Intronic
1155740900 18:29286364-29286386 GTGCCTGTCATTTGCAGGTCAGG - Intergenic
1156183228 18:34630380-34630402 CTGCATGTGATTAGCAGCTAAGG - Intronic
1158609721 18:58928179-58928201 CTGCCTGTGAGCACCAGCTGGGG + Intronic
1159954833 18:74511945-74511967 CTGCCTGTCATCCCCAGTGCTGG + Intronic
1161321104 19:3641940-3641962 CTGGCTGTCACTCCCAGCCCGGG + Intronic
1161744063 19:6044179-6044201 GTGCTTGTCATTACCTGCTGGGG + Exonic
1166712479 19:44946043-44946065 CAGGCTGTCCTCACCAGCTCCGG - Exonic
1167118788 19:47503984-47504006 GAGTGTGTCATTACCAGCTCAGG + Intronic
1168536212 19:57172432-57172454 CTGCCTGACATCAACCGCTCTGG - Intergenic
925046666 2:777785-777807 CTGCCTGTGATGACCAGATGTGG - Intergenic
926163277 2:10502687-10502709 CTGCCTCTCAACACCACCTCTGG + Intergenic
928691538 2:33804653-33804675 TTACCTGTCATTGCTAGCTCTGG + Intergenic
932570996 2:72938364-72938386 CTCCCCATTATTACCAGCTCTGG - Intergenic
933974436 2:87497085-87497107 CTGCCTGGCACTACCAACTGTGG - Intergenic
934096498 2:88611119-88611141 CTCCCTTTCTTTACAAGCTCAGG - Intronic
935594851 2:104870395-104870417 GTGCTTGTCACTAGCAGCTCAGG + Intergenic
936098088 2:109549454-109549476 CTGGGTGGCATTTCCAGCTCTGG + Intronic
936319388 2:111453734-111453756 CTGCCTGGCACTACCAACTGTGG + Intergenic
936530297 2:113271620-113271642 CTGCCTGTCACTGCCAGCACGGG + Intronic
938108254 2:128547757-128547779 GACCCTGTCATTAGCAGCTCTGG + Intergenic
938201114 2:129373852-129373874 CTGCCTGACACTGCCACCTCAGG - Intergenic
938747394 2:134292642-134292664 CTGCCAGTCATTACTAGGTGTGG + Intronic
940055371 2:149507476-149507498 TTGACTGTCAGTACTAGCTCTGG + Intergenic
940196214 2:151097157-151097179 CTATCTGAAATTACCAGCTCTGG + Intergenic
941350414 2:164425899-164425921 CTGCATGTCATTAAGAGTTCAGG - Intergenic
942636499 2:178012534-178012556 CTGCCTGTCATTAGCTGAGCTGG + Intronic
948603519 2:239120714-239120736 CTGCCTTTCTTTAGCAGCCCAGG + Intronic
948933934 2:241150288-241150310 CCGCCTGAAATTACCTGCTCTGG + Exonic
1169112013 20:3040316-3040338 CTGCCTGCCATTGCCAGGGCTGG + Intergenic
1171083878 20:22217942-22217964 CTGGCTGCCACTACCTGCTCAGG - Intergenic
1172997635 20:39083009-39083031 CTGCCTGTCATTGCCTCCCCAGG + Intergenic
1173169000 20:40707271-40707293 CTGACATTCCTTACCAGCTCAGG - Intergenic
1173306325 20:41853897-41853919 CTGCCTCTCATTTCCTGCCCAGG + Intergenic
1174427493 20:50442759-50442781 ATGCCTGTCCTTCCCAGCTGAGG - Intergenic
1175401496 20:58702012-58702034 CTCCCTGTCCTTCCCAGCCCAGG - Intronic
1177072371 21:16526627-16526649 CAACCTGTGATGACCAGCTCAGG - Intergenic
1182299408 22:29329374-29329396 CTGCCTGTGATCTCAAGCTCAGG - Intronic
1183352365 22:37341402-37341424 CTGCCTTTCCTCTCCAGCTCTGG + Intergenic
1183501931 22:38185453-38185475 CTGCCTCTCATTGGCAACTCTGG - Intronic
1183871218 22:40743922-40743944 GTGCCTGTAATCTCCAGCTCAGG - Intergenic
1184489795 22:44801962-44801984 CTGCCTGTGCCTCCCAGCTCGGG + Intronic
1185023756 22:48396085-48396107 CAGCCTGCCATTTCCAGCTGAGG + Intergenic
951234942 3:20223663-20223685 CGGCCTGTCATTCACAGCACAGG - Intergenic
954780492 3:53055713-53055735 GTGCCTGTCATTACCACGCCTGG + Intronic
957732591 3:84159500-84159522 CAGCCTGTGATTACAACCTCTGG + Intergenic
959342099 3:105144596-105144618 CTGCCTGACATTGCAAGCTCTGG - Intergenic
960919303 3:122730371-122730393 CTCCGTGTCAGTATCAGCTCTGG - Exonic
968878996 4:3288968-3288990 CTGCCTGCCATTCCCTGCCCAGG + Intergenic
969049716 4:4364053-4364075 CTACCTGTCCTCATCAGCTCAGG + Intronic
972903743 4:43718583-43718605 CTTCCTTGCATTACCACCTCTGG + Intergenic
975481578 4:74886442-74886464 CTGTCTGTCTTTACCAGATGAGG - Intergenic
985487902 5:162315-162337 CTGCCTGCCATTAGGAGCCCGGG + Intronic
995424922 5:112010306-112010328 CTGCCTGTCATTTGCAGCCTTGG - Intergenic
995597755 5:113765743-113765765 CTGTCTGCCTTTATCAGCTCAGG + Intergenic
995710636 5:115031986-115032008 CTGCCTGCCATTTCCAGTTCAGG + Intergenic
998610455 5:143682661-143682683 CTGCCTGTCATTAAGAGCTCTGG + Intergenic
999304153 5:150509002-150509024 CTGCCTGACCTTACAAGCTGGGG + Intronic
1006569565 6:34990379-34990401 CAGCCTGTTATTACCACCTCTGG + Intronic
1006739067 6:36294388-36294410 CTGCCTCTCACCACCAGGTCCGG - Exonic
1007225660 6:40312056-40312078 CTGCCACTGATTCCCAGCTCAGG + Intergenic
1010250526 6:73702451-73702473 CTGCCTGTGAAAACCTGCTCTGG - Intronic
1012126625 6:95436697-95436719 CTCCCTTTCTTTACCAGCTTTGG + Intergenic
1012358794 6:98350599-98350621 CTGCCTGCAGTTTCCAGCTCAGG - Intergenic
1013819291 6:114135502-114135524 CCGCCTGTCTGTTCCAGCTCCGG - Intronic
1014781311 6:125567956-125567978 CTTACTGTCATAATCAGCTCAGG + Intergenic
1016649027 6:146442385-146442407 CTTGCTGTCATTAAGAGCTCAGG - Intergenic
1018225254 6:161622199-161622221 CTCCCTGTCACCACCTGCTCTGG + Intronic
1019095429 6:169575528-169575550 CTGCCTGCCTTCAACAGCTCAGG - Intronic
1019724725 7:2595262-2595284 CTGCCTCTCAGTGACAGCTCCGG - Intronic
1021542172 7:21771961-21771983 CTTCCTGACATTAACAGCTGTGG - Intronic
1025189714 7:56887336-56887358 CTGCTGGTCATGTCCAGCTCCGG + Intergenic
1025682224 7:63689585-63689607 CTGCTGGTCATGTCCAGCTCCGG - Intergenic
1028530960 7:91838119-91838141 TTACCTGTCAATACCTGCTCTGG - Intronic
1028747148 7:94340024-94340046 CTCTCTGTCTTTTCCAGCTCAGG - Intergenic
1029049987 7:97675697-97675719 CAGCCTGTCCTTAGAAGCTCTGG - Intergenic
1031127604 7:117792119-117792141 CTGCCTGTCAATACCTGGTCTGG + Exonic
1034855756 7:154545038-154545060 CTTGCTGTAATTACCAGCTCTGG - Intronic
1034982859 7:155489739-155489761 CTTCCTGGCCTTACCAGCTCCGG - Intronic
1036088265 8:5636949-5636971 TTGCATGTCATTACCAACGCAGG - Intergenic
1042050866 8:64705058-64705080 CTTTCAGTCATTCCCAGCTCTGG + Intronic
1045393179 8:101735199-101735221 ATGTCTGTGATTACCAGCACAGG + Intronic
1045747635 8:105441860-105441882 CTGCCTGACTGTACCTGCTCTGG - Intronic
1048244563 8:132778978-132779000 CTGCCTGCCATTGCCAACTCGGG - Intronic
1049579055 8:143402724-143402746 TTGCTTGTCATCACCAGCTGTGG + Intergenic
1049795334 8:144494740-144494762 CTTTCTGTCATTAGCATCTCTGG - Intronic
1050110818 9:2214018-2214040 CTCCCTGTTCTTCCCAGCTCAGG + Intergenic
1055033206 9:71791402-71791424 CTGCCTGTCATTACCAGCTCCGG - Intronic
1057192316 9:93094994-93095016 AGGCCTGGCATTTCCAGCTCCGG - Intergenic
1060115030 9:120933639-120933661 CTGCCTTTCTTTGCCATCTCTGG + Intergenic
1060223782 9:121778790-121778812 CTCCCTGTCATTACAGCCTCAGG - Intronic
1061755792 9:132811649-132811671 CTGCCTGTCTTTGCCATCTCTGG - Intronic
1061912717 9:133733574-133733596 CTGCCTGGAGTTTCCAGCTCTGG + Intronic
1187262408 X:17698624-17698646 CTGACTGTCTTTATCAGTTCAGG - Intronic
1189491862 X:41476216-41476238 CTGCCTGTTGTGACCAGCTTAGG - Intergenic
1195755199 X:108192803-108192825 CTGCCTTTCATGATAAGCTCTGG + Intronic
1197501434 X:127246691-127246713 CAGCCTTTCGTTACTAGCTCTGG + Intergenic
1197789636 X:130241286-130241308 CTGTCTGTCATTCTCAACTCTGG + Intronic
1198946082 X:142015788-142015810 CTGCCTGTCATCACTAGTACTGG - Intergenic
1200069532 X:153521145-153521167 CTGCCTGGCATACCCAGCCCGGG - Intronic
1200700549 Y:6398521-6398543 CTGCATGTCATTCCCTGCTGTGG - Intergenic
1200706981 Y:6451591-6451613 CTGCCTGTGATAACCCACTCTGG + Intergenic
1200917979 Y:8588211-8588233 CTGCCTGTGATAACCCGCTTTGG - Intergenic
1201027131 Y:9713117-9713139 CTGCCTGTGATAACCCACTCTGG - Intergenic
1201033563 Y:9766177-9766199 CTGCATGTCATTCCCTGCTGTGG + Intergenic
1201765743 Y:17572171-17572193 CTGTATGTCATTATCAGGTCGGG + Intergenic
1201835809 Y:18333818-18333840 CTGTATGTCATTATCAGGTCGGG - Intergenic
1202182004 Y:22147699-22147721 CTGCCTGTGATAACCAACTGGGG + Intergenic
1202209356 Y:22438703-22438725 CTGCCTGTGATAACCAACTGGGG - Intergenic