ID: 1055035565

View in Genome Browser
Species Human (GRCh38)
Location 9:71814693-71814715
Sequence CGTTTCAGTCCTCCCTAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055035563_1055035565 -5 Left 1055035563 9:71814675-71814697 CCCAAGTATCGTAAGTCACGTTT 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1055035565 9:71814693-71814715 CGTTTCAGTCCTCCCTAATACGG No data
1055035562_1055035565 29 Left 1055035562 9:71814641-71814663 CCAAAGCACTGAATTTCACTCAT 0: 1
1: 0
2: 3
3: 13
4: 211
Right 1055035565 9:71814693-71814715 CGTTTCAGTCCTCCCTAATACGG No data
1055035564_1055035565 -6 Left 1055035564 9:71814676-71814698 CCAAGTATCGTAAGTCACGTTTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1055035565 9:71814693-71814715 CGTTTCAGTCCTCCCTAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055035565 Original CRISPR CGTTTCAGTCCTCCCTAATA CGG Intronic
No off target data available for this crispr