ID: 1055036124

View in Genome Browser
Species Human (GRCh38)
Location 9:71820461-71820483
Sequence GTTAACGAATCCTTGCCTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055036124_1055036127 -5 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036127 9:71820479-71820501 TTAACTAGCTGCAGAAAGATGGG No data
1055036124_1055036131 24 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036131 9:71820508-71820530 CCCGAGCAAGGTGCTGAGCCAGG No data
1055036124_1055036128 1 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG No data
1055036124_1055036133 29 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036133 9:71820513-71820535 GCAAGGTGCTGAGCCAGGAAAGG No data
1055036124_1055036129 12 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036129 9:71820496-71820518 GATGGGCTAAGGCCCGAGCAAGG No data
1055036124_1055036126 -6 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036126 9:71820478-71820500 GTTAACTAGCTGCAGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055036124 Original CRISPR GTTAACGAATCCTTGCCTAC GGG (reversed) Intergenic
No off target data available for this crispr