ID: 1055036128

View in Genome Browser
Species Human (GRCh38)
Location 9:71820485-71820507
Sequence AGCTGCAGAAAGATGGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055036125_1055036128 0 Left 1055036125 9:71820462-71820484 CCGTAGGCAAGGATTCGTTAACT No data
Right 1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG No data
1055036120_1055036128 16 Left 1055036120 9:71820446-71820468 CCACCTTTCTGTCTACCCGTAGG No data
Right 1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG No data
1055036122_1055036128 13 Left 1055036122 9:71820449-71820471 CCTTTCTGTCTACCCGTAGGCAA No data
Right 1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG No data
1055036124_1055036128 1 Left 1055036124 9:71820461-71820483 CCCGTAGGCAAGGATTCGTTAAC No data
Right 1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055036128 Original CRISPR AGCTGCAGAAAGATGGGCTA AGG Intergenic
No off target data available for this crispr